Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0431151736:

Variant ID: vg0431151736 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31151736
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGTGGCCGGCGGCCGCGAGGGGTAGTGGCGGCCAGCGGCTCAGCGCTTCGACAGGAATATTCAACTTTAAAATTCTAGCTCCACCACTGGATACACAC[A/G]
CCAAAAGAAAACCCATTCGTTACCTCAAAAAGTGGAGGATCTACTCTGCAGTGATCTACTCTGCAGTTCCGAGTCTCCGACTCTGAAGCTATTGCTCCGC

Reverse complement sequence

GCGGAGCAATAGCTTCAGAGTCGGAGACTCGGAACTGCAGAGTAGATCACTGCAGAGTAGATCCTCCACTTTTTGAGGTAACGAATGGGTTTTCTTTTGG[T/C]
GTGTGTATCCAGTGGTGGAGCTAGAATTTTAAAGTTGAATATTCCTGTCGAAGCGCTGAGCCGCTGGCCGCCACTACCCCTCGCGGCCGCCGGCCACCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 11.90% 0.63% 32.01% NA
All Indica  2759 39.00% 9.50% 0.87% 50.71% NA
All Japonica  1512 79.70% 17.80% 0.13% 2.38% NA
Aus  269 79.20% 5.60% 0.74% 14.50% NA
Indica I  595 15.80% 19.20% 1.01% 64.03% NA
Indica II  465 31.40% 10.50% 1.29% 56.77% NA
Indica III  913 58.90% 0.90% 0.66% 39.54% NA
Indica Intermediate  786 37.80% 11.50% 0.76% 50.00% NA
Temperate Japonica  767 76.90% 22.60% 0.13% 0.39% NA
Tropical Japonica  504 92.70% 2.20% 0.00% 5.16% NA
Japonica Intermediate  241 61.40% 35.30% 0.41% 2.90% NA
VI/Aromatic  96 71.90% 12.50% 0.00% 15.62% NA
Intermediate  90 63.30% 7.80% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431151736 A -> DEL N N silent_mutation Average:65.868; most accessible tissue: Minghui63 root, score: 94.078 N N N N
vg0431151736 A -> G LOC_Os04g52420.1 intron_variant ; MODIFIER silent_mutation Average:65.868; most accessible tissue: Minghui63 root, score: 94.078 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431151736 A G -0.06 -0.03 -0.03 -0.02 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431151736 NA 7.26E-07 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431151736 4.79E-06 NA mr1805_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431151736 5.74E-06 NA mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251