\
| Variant ID: vg0431094486 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31094486 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 73. )
TCATATTTGCAAACAAAAAATAATTTGTGAATAAAACTTTTATATACGTGTTCTTAGTGATCTAAAAGCAAATGCTGAAAAATAAATTACGATGAGAAAA[C/T]
CCAAAAATCAACACCAAATTTAAGGTGGAAAATTTAAATTTTGGCTGATAAATATAAGCATAAAGAAAAGATGAGGCCCGTCCTGTGGAATTCAGTGTAG
CTACACTGAATTCCACAGGACGGGCCTCATCTTTTCTTTATGCTTATATTTATCAGCCAAAATTTAAATTTTCCACCTTAAATTTGGTGTTGATTTTTGG[G/A]
TTTTCTCATCGTAATTTATTTTTCAGCATTTGCTTTTAGATCACTAAGAACACGTATATAAAAGTTTTATTCACAAATTATTTTTTGTTTGCAAATATGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.60% | 0.19% | 0.06% | NA |
| All Indica | 2759 | 90.90% | 8.80% | 0.29% | 0.07% | NA |
| All Japonica | 1512 | 5.00% | 94.90% | 0.07% | 0.07% | NA |
| Aus | 269 | 30.90% | 69.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.00% | 18.50% | 0.34% | 0.17% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 2.80% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 89.30% | 10.20% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 89.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431094486 | C -> DEL | N | N | silent_mutation | Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| vg0431094486 | C -> T | LOC_Os04g52320.1 | downstream_gene_variant ; 1629.0bp to feature; MODIFIER | silent_mutation | Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| vg0431094486 | C -> T | LOC_Os04g52330.1 | downstream_gene_variant ; 1112.0bp to feature; MODIFIER | silent_mutation | Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| vg0431094486 | C -> T | LOC_Os04g52340.1 | downstream_gene_variant ; 3988.0bp to feature; MODIFIER | silent_mutation | Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| vg0431094486 | C -> T | LOC_Os04g52320-LOC_Os04g52330 | intergenic_region ; MODIFIER | silent_mutation | Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431094486 | NA | 4.70E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 3.92E-06 | mr1011_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 4.21E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 4.33E-06 | mr1031_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 2.46E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 1.31E-06 | mr1522_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 6.42E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 1.07E-21 | mr1627_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 6.55E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431094486 | NA | 4.38E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |