\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431094486:

Variant ID: vg0431094486 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31094486
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TCATATTTGCAAACAAAAAATAATTTGTGAATAAAACTTTTATATACGTGTTCTTAGTGATCTAAAAGCAAATGCTGAAAAATAAATTACGATGAGAAAA[C/T]
CCAAAAATCAACACCAAATTTAAGGTGGAAAATTTAAATTTTGGCTGATAAATATAAGCATAAAGAAAAGATGAGGCCCGTCCTGTGGAATTCAGTGTAG

Reverse complement sequence

CTACACTGAATTCCACAGGACGGGCCTCATCTTTTCTTTATGCTTATATTTATCAGCCAAAATTTAAATTTTCCACCTTAAATTTGGTGTTGATTTTTGG[G/A]
TTTTCTCATCGTAATTTATTTTTCAGCATTTGCTTTTAGATCACTAAGAACACGTATATAAAAGTTTTATTCACAAATTATTTTTTGTTTGCAAATATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.60% 0.19% 0.06% NA
All Indica  2759 90.90% 8.80% 0.29% 0.07% NA
All Japonica  1512 5.00% 94.90% 0.07% 0.07% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 81.00% 18.50% 0.34% 0.17% NA
Indica II  465 94.40% 5.60% 0.00% 0.00% NA
Indica III  913 96.80% 2.80% 0.22% 0.11% NA
Indica Intermediate  786 89.30% 10.20% 0.51% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 10.00% 89.20% 0.41% 0.41% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431094486 C -> DEL N N silent_mutation Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0431094486 C -> T LOC_Os04g52320.1 downstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0431094486 C -> T LOC_Os04g52330.1 downstream_gene_variant ; 1112.0bp to feature; MODIFIER silent_mutation Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0431094486 C -> T LOC_Os04g52340.1 downstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0431094486 C -> T LOC_Os04g52320-LOC_Os04g52330 intergenic_region ; MODIFIER silent_mutation Average:50.475; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431094486 NA 4.70E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 3.92E-06 mr1011_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 4.21E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 4.33E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 2.46E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 1.31E-06 mr1522_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 6.42E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 1.07E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 6.55E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094486 NA 4.38E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251