Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431094191:

Variant ID: vg0431094191 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31094191
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTAAAAGTCTCTTACTAGAGTTGGTTAGAGTTGCACAATTTCACTGTCACCATGAGCTTACTTTAAGATTTGGCAATCCTGTACATATGATGCATTG[T/C]
CTTTTAAGTTTCACTAATCACTGTCAAAACACGAGAAAAACATGGCATTATTTTGCTGAACCAGTCAAACAGTTACCATTAAAAAAAGTTAAACAGTTAA

Reverse complement sequence

TTAACTGTTTAACTTTTTTTAATGGTAACTGTTTGACTGGTTCAGCAAAATAATGCCATGTTTTTCTCGTGTTTTGACAGTGATTAGTGAAACTTAAAAG[A/G]
CAATGCATCATATGTACAGGATTGCCAAATCTTAAAGTAAGCTCATGGTGACAGTGAAATTGTGCAACTCTAACCAACTCTAGTAAGAGACTTTTAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.80%	44.90%	0.15%	0.11%	NA
All Indica	2759	85.10%	14.50%	0.25%	0.14%	NA
All Japonica	1512	5.10%	94.80%	0.00%	0.07%	NA
Aus	269	21.60%	78.40%	0.00%	0.00%	NA
Indica I	595	80.70%	18.80%	0.34%	0.17%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	84.20%	15.40%	0.22%	0.11%	NA
Indica Intermediate	786	84.40%	15.00%	0.38%	0.25%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	94.20%	0.00%	0.00%	NA
Japonica Intermediate	241	10.40%	89.20%	0.00%	0.41%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431094191	T -> C	LOC_Os04g52320.1	downstream_gene_variant ; 1334.0bp to feature; MODIFIER	silent_mutation	Average:62.253; most accessible tissue: Zhenshan97 flower, score: 90.696	N	N	N	N
vg0431094191	T -> C	LOC_Os04g52330.1	downstream_gene_variant ; 1407.0bp to feature; MODIFIER	silent_mutation	Average:62.253; most accessible tissue: Zhenshan97 flower, score: 90.696	N	N	N	N
vg0431094191	T -> C	LOC_Os04g52340.1	downstream_gene_variant ; 4283.0bp to feature; MODIFIER	silent_mutation	Average:62.253; most accessible tissue: Zhenshan97 flower, score: 90.696	N	N	N	N
vg0431094191	T -> C	LOC_Os04g52320-LOC_Os04g52330	intergenic_region ; MODIFIER	silent_mutation	Average:62.253; most accessible tissue: Zhenshan97 flower, score: 90.696	N	N	N	N
vg0431094191	T -> DEL	N	N	silent_mutation	Average:62.253; most accessible tissue: Zhenshan97 flower, score: 90.696	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0431094191	T	C	-0.05	-0.01	-0.01	0.0	0.03	0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431094191	NA	3.76E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	3.69E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	6.05E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	1.04E-06	1.04E-06	mr1320	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	5.18E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	1.86E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	8.21E-12	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	7.93E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	9.23E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	9.51E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	5.49E-06	mr1522_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	3.24E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	6.49E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	1.38E-20	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	1.21E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431094191	NA	2.82E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251