Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431076967:

Variant ID: vg0431076967 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 31076967
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTGTGCGCGCGTCCCTGTTAGGTCTAGCTTCCACTGGGTGTTGTTTACTGCTCAATCTATACTTTACCACTGTAGCTTCTGCCACCAATCGGTTGGT[C/T]
ATGTGTATGCCTGTGTGAATTCCACTGGGTGTGTGTGCACATGTATGAATGTGTGATGCAAACCAATATGGTAGATCCAGTGGATGCTTATACTATTAAC

Reverse complement sequence

GTTAATAGTATAAGCATCCACTGGATCTACCATATTGGTTTGCATCACACATTCATACATGTGCACACACACCCAGTGGAATTCACACAGGCATACACAT[G/A]
ACCAACCGATTGGTGGCAGAAGCTACAGTGGTAAAGTATAGATTGAGCAGTAAACAACACCCAGTGGAAGCTAGACCTAACAGGGACGCGCGCACAGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.60% 0.00% 0.00% NA
All Indica  2759 87.20% 12.80% 0.00% 0.00% NA
All Japonica  1512 77.10% 22.90% 0.00% 0.00% NA
Aus  269 66.50% 33.50% 0.00% 0.00% NA
Indica I  595 85.50% 14.50% 0.00% 0.00% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 83.40% 16.60% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.40% 0.00% 0.00% NA
Temperate Japonica  767 72.00% 28.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 52.70% 47.30% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0431076967 C -> T LOC_Os04g52290.1 upstream_gene_variant ; 623.0bp to feature; MODIFIER silent_mutation Average:92.031; most accessible tissue: Minghui63 flag leaf, score: 95.347 N N N N
vg0431076967 C -> T LOC_Os04g52280.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:92.031; most accessible tissue: Minghui63 flag leaf, score: 95.347 N N N N
vg0431076967 C -> T LOC_Os04g52310.1 downstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:92.031; most accessible tissue: Minghui63 flag leaf, score: 95.347 N N N N
vg0431076967 C -> T LOC_Os04g52300.1 intron_variant ; MODIFIER silent_mutation Average:92.031; most accessible tissue: Minghui63 flag leaf, score: 95.347 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0431076967 C T 0.0 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0431076967 NA 2.79E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431076967 NA 9.50E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431076967 1.28E-07 NA mr1100_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431076967 NA 3.36E-08 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431076967 NA 2.27E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431076967 NA 1.09E-08 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431076967 NA 4.15E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251