\
| Variant ID: vg0431043984 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31043984 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 322. )
ACCAGTACTAGTGATTATCTCCATCACTCTCTCACTTCACTTGGAGAGATTAATTAGTTGGAGTGTGTGCTGTGCTATCAGTGTGTCTTTCTTTGTGTTT[C/A]
TTTTTGGTTTGGACGTTTTGCCTTTAATTTCTTGTTGTTTAATTTTGGTATCTATGCTTTCTTGCCACTAGAGCAAAACTGAGAGAGAGATAGAGGGATA
TATCCCTCTATCTCTCTCTCAGTTTTGCTCTAGTGGCAAGAAAGCATAGATACCAAAATTAAACAACAAGAAATTAAAGGCAAAACGTCCAAACCAAAAA[G/T]
AAACACAAAGAAAGACACACTGATAGCACAGCACACACTCCAACTAATTAATCTCTCCAAGTGAAGTGAGAGAGTGATGGAGATAATCACTAGTACTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.80% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 88.80% | 10.70% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 78.70% | 20.20% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431043984 | C -> A | LOC_Os04g52240.1 | downstream_gene_variant ; 559.0bp to feature; MODIFIER | silent_mutation | Average:71.275; most accessible tissue: Callus, score: 94.088 | N | N | N | N |
| vg0431043984 | C -> A | LOC_Os04g52240-LOC_Os04g52250 | intergenic_region ; MODIFIER | silent_mutation | Average:71.275; most accessible tissue: Callus, score: 94.088 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431043984 | 5.13E-07 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | NA | 2.25E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 7.23E-06 | NA | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 5.68E-06 | 5.68E-06 | mr1360_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 7.53E-07 | NA | mr1371_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | NA | 9.53E-07 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 9.57E-07 | 7.52E-07 | mr1445_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 4.52E-06 | 4.52E-06 | mr1445_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 2.32E-06 | NA | mr1648_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 6.59E-07 | NA | mr1655_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 4.54E-06 | 4.54E-06 | mr1655_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | 9.66E-07 | NA | mr1669_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431043984 | NA | 1.83E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |