| Variant ID: vg0431016407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 31016407 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGCTTCTGCAGATATCCAAGGGACATTTAACTTCTTGCCACTTTTAAGATGTGTCAATTAATTATTTGCCACTCGTTGTCTATGACATGTGGGTCCAGT[G/T]
GCAAATAATTTAGCACCACTCGTAAGAGTGGCAAATAGTTAATTATTCCTATCCCGAATAGAACTGATCACCGGATATCCGAATTATTGTCCATATTCGA
TCGAATATGGACAATAATTCGGATATCCGGTGATCAGTTCTATTCGGGATAGGAATAATTAACTATTTGCCACTCTTACGAGTGGTGCTAAATTATTTGC[C/A]
ACTGGACCCACATGTCATAGACAACGAGTGGCAAATAATTAATTGACACATCTTAAAAGTGGCAAGAAGTTAAATGTCCCTTGGATATCTGCAGAAGCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.20% | 3.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.30% | 11.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 77.80% | 21.80% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0431016407 | G -> T | LOC_Os04g52200.1 | upstream_gene_variant ; 2492.0bp to feature; MODIFIER | silent_mutation | Average:33.855; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0431016407 | G -> T | LOC_Os04g52210.1 | upstream_gene_variant ; 2960.0bp to feature; MODIFIER | silent_mutation | Average:33.855; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0431016407 | G -> T | LOC_Os04g52200-LOC_Os04g52210 | intergenic_region ; MODIFIER | silent_mutation | Average:33.855; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0431016407 | 8.93E-08 | NA | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | NA | 2.25E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | 5.68E-06 | 5.68E-06 | mr1360_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | NA | 3.21E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | 4.52E-06 | 4.52E-06 | mr1445_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | 4.54E-06 | 4.54E-06 | mr1655_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | 9.34E-06 | NA | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0431016407 | NA | 1.83E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |