Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0431016407:

Variant ID: vg0431016407 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 31016407
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGCTTCTGCAGATATCCAAGGGACATTTAACTTCTTGCCACTTTTAAGATGTGTCAATTAATTATTTGCCACTCGTTGTCTATGACATGTGGGTCCAGT[G/T]
GCAAATAATTTAGCACCACTCGTAAGAGTGGCAAATAGTTAATTATTCCTATCCCGAATAGAACTGATCACCGGATATCCGAATTATTGTCCATATTCGA

Reverse complement sequence

TCGAATATGGACAATAATTCGGATATCCGGTGATCAGTTCTATTCGGGATAGGAATAATTAACTATTTGCCACTCTTACGAGTGGTGCTAAATTATTTGC[C/A]
ACTGGACCCACATGTCATAGACAACGAGTGGCAAATAATTAATTGACACATCTTAAAAGTGGCAAGAAGTTAAATGTCCCTTGGATATCTGCAGAAGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	3.70%	0.06%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	88.30%	11.50%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	77.80%	21.80%	0.39%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0431016407	G -> T	LOC_Os04g52200.1	upstream_gene_variant ; 2492.0bp to feature; MODIFIER	silent_mutation	Average:33.855; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0431016407	G -> T	LOC_Os04g52210.1	upstream_gene_variant ; 2960.0bp to feature; MODIFIER	silent_mutation	Average:33.855; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0431016407	G -> T	LOC_Os04g52200-LOC_Os04g52210	intergenic_region ; MODIFIER	silent_mutation	Average:33.855; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0431016407	8.93E-08	NA	mr1062_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	NA	2.25E-09	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	5.68E-06	5.68E-06	mr1360_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	NA	3.21E-06	mr1439_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	4.52E-06	4.52E-06	mr1445_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	4.54E-06	4.54E-06	mr1655_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	9.34E-06	NA	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0431016407	NA	1.83E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251