\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430980193:

Variant ID: vg0430980193 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30980193
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTAGTGACATCTAACTTAAGCTGATGGTTGCATTTGGGCTTACCTAGTACGTACAACTACATGCAGAAGTCCAGCTTGTGTTAGGAATCTAAACTAT[A/C]
TGTTCCAGCAGTCACAGGAAACAGGGTCGGTGGCAGCGTTTCTTGACCCGGGAACACGGGATCATTTTTGTCCCCACCTTGTAAAAACCTCTAGCAAGTA

Reverse complement sequence

TACTTGCTAGAGGTTTTTACAAGGTGGGGACAAAAATGATCCCGTGTTCCCGGGTCAAGAAACGCTGCCACCGACCCTGTTTCCTGTGACTGCTGGAACA[T/G]
ATAGTTTAGATTCCTAACACAAGCTGGACTTCTGCATGTAGTTGTACGTACTAGGTAAGCCCAAATGCAACCATCAGCTTAAGTTAGATGTCACTAAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.60% 0.32% 0.08% NA
All Indica  2759 96.80% 2.90% 0.33% 0.04% NA
All Japonica  1512 26.20% 73.40% 0.26% 0.13% NA
Aus  269 36.40% 63.20% 0.37% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 92.90% 6.00% 0.86% 0.22% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.30% 0.51% 0.00% NA
Temperate Japonica  767 42.50% 57.10% 0.26% 0.13% NA
Tropical Japonica  504 4.80% 95.00% 0.20% 0.00% NA
Japonica Intermediate  241 19.10% 80.10% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 58.90% 40.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430980193 A -> C LOC_Os04g52140.1 downstream_gene_variant ; 344.0bp to feature; MODIFIER silent_mutation Average:66.157; most accessible tissue: Callus, score: 98.169 N N N N
vg0430980193 A -> C LOC_Os04g52140-LOC_Os04g52164 intergenic_region ; MODIFIER silent_mutation Average:66.157; most accessible tissue: Callus, score: 98.169 N N N N
vg0430980193 A -> DEL N N silent_mutation Average:66.157; most accessible tissue: Callus, score: 98.169 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430980193 A C 0.04 0.03 0.03 0.01 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430980193 NA 9.45E-12 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 9.79E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.41E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 2.50E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 8.40E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.88E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 7.27E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 7.05E-07 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 7.74E-06 7.74E-06 mr1452_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.17E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 9.93E-07 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.39E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.28E-18 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.89E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 3.84E-06 4.22E-17 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 2.69E-07 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 1.85E-06 1.30E-10 mr1786_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 1.87E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 6.43E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 3.93E-06 3.93E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430980193 NA 4.02E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251