Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430967841:

Variant ID: vg0430967841 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30967841
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTTTGATATATCTAATCTAACTATCTAAGGATCACAGATCCACGTTGGATTGAAGTTAAATTATAATAGTTCAAAATATTATATTATCTAAAATAAA[T/A]
AAAATAAAATAATTTGTTCAATTATTATCAATATAATTACATATCCAAGTCTATTGATTTCTGGAGTTATGAATAGTCAGCTCCAAGAAATCTCGAATAT

Reverse complement sequence

ATATTCGAGATTTCTTGGAGCTGACTATTCATAACTCCAGAAATCAATAGACTTGGATATGTAATTATATTGATAATAATTGAACAAATTATTTTATTTT[A/T]
TTTATTTTAGATAATATAATATTTTGAACTATTATAATTTAACTTCAATCCAACGTGGATCTGTGATCCTTAGATAGTTAGATTAGATATATCAAAATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 34.40% 0.59% 0.00% NA
All Indica  2759 88.30% 11.00% 0.65% 0.00% NA
All Japonica  1512 26.30% 73.30% 0.46% 0.00% NA
Aus  269 36.10% 63.90% 0.00% 0.00% NA
Indica I  595 96.50% 2.40% 1.18% 0.00% NA
Indica II  465 91.60% 7.50% 0.86% 0.00% NA
Indica III  913 80.70% 19.10% 0.22% 0.00% NA
Indica Intermediate  786 89.10% 10.30% 0.64% 0.00% NA
Temperate Japonica  767 42.60% 57.00% 0.39% 0.00% NA
Tropical Japonica  504 4.80% 94.80% 0.40% 0.00% NA
Japonica Intermediate  241 19.10% 80.10% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430967841 T -> A LOC_Os04g52130.1 downstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:61.357; most accessible tissue: Zhenshan97 flower, score: 93.962 N N N N
vg0430967841 T -> A LOC_Os04g52130-LOC_Os04g52140 intergenic_region ; MODIFIER silent_mutation Average:61.357; most accessible tissue: Zhenshan97 flower, score: 93.962 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430967841 T A -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430967841 NA 2.11E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 1.44E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 9.12E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 5.78E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 2.06E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 3.14E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 3.02E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 4.33E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 2.00E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 9.96E-07 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 4.16E-07 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 4.07E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 7.67E-06 4.25E-19 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 8.90E-06 mr1666_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 1.80E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 3.36E-07 2.10E-18 mr1761_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 1.76E-08 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 6.97E-10 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 3.17E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 3.05E-06 3.05E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430967841 NA 1.55E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251