\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430941234:

Variant ID: vg0430941234 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30941234
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTGGGTCCACCACCGCGCGGGGGCCCCACGACCCAACCAACCGTGTGGCTCGGATCGTGTTTGTCATGTGGTGGCCGGCGTCGCGGTCGCGGGGCGGC[T/C]
AGTCGGCTACAGTAGGCGTCCTCGCCTTTTGTTCCGCACAAGGATTGGTTGGTTTGGTTGGTTGTTTGGATCGATCTGCGACTGCGAGTCGAGCCGCGAG

Reverse complement sequence

CTCGCGGCTCGACTCGCAGTCGCAGATCGATCCAAACAACCAACCAAACCAACCAATCCTTGTGCGGAACAAAAGGCGAGGACGCCTACTGTAGCCGACT[A/G]
GCCGCCCCGCGACCGCGACGCCGGCCACCACATGACAAACACGATCCGAGCCACACGGTTGGTTGGGTCGTGGGGCCCCCGCGCGGTGGTGGACCCACGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 46.00% 0.21% 0.00% NA
All Indica  2759 71.70% 28.10% 0.25% 0.00% NA
All Japonica  1512 28.60% 71.30% 0.13% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 86.70% 13.10% 0.17% 0.00% NA
Indica II  465 89.90% 10.10% 0.00% 0.00% NA
Indica III  913 52.90% 46.80% 0.33% 0.00% NA
Indica Intermediate  786 71.40% 28.20% 0.38% 0.00% NA
Temperate Japonica  767 44.10% 55.80% 0.13% 0.00% NA
Tropical Japonica  504 11.70% 88.30% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 85.10% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 54.20% 1.04% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430941234 T -> C LOC_Os04g52090.1 downstream_gene_variant ; 959.0bp to feature; MODIFIER silent_mutation Average:99.847; most accessible tissue: Zhenshan97 young leaf, score: 99.967 N N N N
vg0430941234 T -> C LOC_Os04g52100.1 downstream_gene_variant ; 3884.0bp to feature; MODIFIER silent_mutation Average:99.847; most accessible tissue: Zhenshan97 young leaf, score: 99.967 N N N N
vg0430941234 T -> C LOC_Os04g52090-LOC_Os04g52100 intergenic_region ; MODIFIER silent_mutation Average:99.847; most accessible tissue: Zhenshan97 young leaf, score: 99.967 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430941234 T C -0.01 0.0 0.01 0.02 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430941234 NA 6.93E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 5.25E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 5.93E-08 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 1.81E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 1.96E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 6.96E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 9.93E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 9.89E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 1.06E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 3.60E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 3.27E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 1.38E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 9.05E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 5.77E-06 5.77E-06 mr1355_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 3.94E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 3.97E-06 3.97E-06 mr1452_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 9.58E-06 9.58E-06 mr1470_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 9.66E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 2.09E-14 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 5.93E-06 mr1666_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 2.69E-06 2.36E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 NA 6.51E-09 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430941234 8.36E-06 8.36E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251