\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430820905:

Variant ID: vg0430820905 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30820905
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTATACTGCCAAATTTTAGTAACTATATAAGAAATCATGTTTTTGGTATAGTTGCCAAATATTTGCTAAATTTTGTTAAGGTTTTTTTCATCAAAG[C/T,A]
GAACAACACGATATACTAGTATAGAACTGGATTTGATTTGATCCTTGTTTAAGCTAATGATAAACACGGTGCCCTCGTTCCCAAATCGCAATTGTGTTCG

Reverse complement sequence

CGAACACAATTGCGATTTGGGAACGAGGGCACCGTGTTTATCATTAGCTTAAACAAGGATCAAATCAAATCCAGTTCTATACTAGTATATCGTGTTGTTC[G/A,T]
CTTTGATGAAAAAAACCTTAACAAAATTTAGCAAATATTTGGCAACTATACCAAAAACATGATTTCTTATATAGTTACTAAAATTTGGCAGTATACTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.30% 0.42% 0.06% A: 0.08%
All Indica  2759 74.10% 25.00% 0.65% 0.07% A: 0.14%
All Japonica  1512 59.00% 40.90% 0.07% 0.00% NA
Aus  269 86.60% 13.40% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 26.00% 73.50% 0.43% 0.00% NA
Indica III  913 82.00% 16.90% 0.66% 0.00% A: 0.44%
Indica Intermediate  786 75.10% 23.40% 1.27% 0.25% NA
Temperate Japonica  767 33.50% 66.50% 0.00% 0.00% NA
Tropical Japonica  504 93.10% 6.70% 0.20% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430820905 C -> DEL N N silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> A LOC_Os04g51940.1 upstream_gene_variant ; 229.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> A LOC_Os04g51940.2 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> A LOC_Os04g51940.3 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> A LOC_Os04g51930.1 downstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> A LOC_Os04g51950.1 downstream_gene_variant ; 4651.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> A LOC_Os04g51930-LOC_Os04g51940 intergenic_region ; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> T LOC_Os04g51940.1 upstream_gene_variant ; 229.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> T LOC_Os04g51940.2 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> T LOC_Os04g51940.3 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> T LOC_Os04g51930.1 downstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> T LOC_Os04g51950.1 downstream_gene_variant ; 4651.0bp to feature; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N
vg0430820905 C -> T LOC_Os04g51930-LOC_Os04g51940 intergenic_region ; MODIFIER silent_mutation Average:92.278; most accessible tissue: Minghui63 young leaf, score: 96.323 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430820905 C A -0.02 -0.06 -0.03 -0.04 -0.03 -0.02
vg0430820905 C T -0.02 -0.05 -0.04 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430820905 NA 3.50E-20 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0430820905 NA 5.30E-07 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 3.23E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 1.51E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 5.19E-07 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 5.21E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 1.22E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 5.14E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 1.81E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 3.96E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 3.97E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 2.25E-07 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 4.04E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 1.01E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 4.86E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 6.87E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 9.77E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 1.16E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 8.93E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 2.23E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 7.35E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 6.09E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 2.48E-06 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 2.95E-06 4.25E-13 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 2.65E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 2.33E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 6.81E-09 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 6.38E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 6.39E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 2.09E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430820905 NA 1.48E-08 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251