\
| Variant ID: vg0430779487 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30779487 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 57. )
ACTCTGTTTTTTCTTTTTCTCTGATTAATGTGAGAATTTCTAAGCCATGAAAGCGAACGTGAAGGCTCCTTTTTCTATTCCTTTAATTATATAATAGATA[G/A]
ATTAGCTGTAAGGTTAGCTACAATTTTTTTTTCCTCTCTCTATTTCTCACTTATACATTTAATGCATTTGTCTTGGAGATTATGTTAAACTAGCTCTTGC
GCAAGAGCTAGTTTAACATAATCTCCAAGACAAATGCATTAAATGTATAAGTGAGAAATAGAGAGAGGAAAAAAAAATTGTAGCTAACCTTACAGCTAAT[C/T]
TATCTATTATATAATTAAAGGAATAGAAAAAGGAGCCTTCACGTTCGCTTTCATGGCTTAGAAATTCTCACATTAATCAGAGAAAAAGAAAAAACAGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.90% | 11.00% | 21.79% | 35.29% | NA |
| All Indica | 2759 | 26.60% | 11.60% | 27.47% | 34.25% | NA |
| All Japonica | 1512 | 41.30% | 10.40% | 11.64% | 36.64% | NA |
| Aus | 269 | 4.10% | 14.10% | 30.11% | 51.67% | NA |
| Indica I | 595 | 2.50% | 9.10% | 38.32% | 50.08% | NA |
| Indica II | 465 | 74.00% | 3.70% | 7.31% | 15.05% | NA |
| Indica III | 913 | 18.90% | 19.50% | 29.90% | 31.65% | NA |
| Indica Intermediate | 786 | 25.80% | 9.20% | 28.37% | 36.64% | NA |
| Temperate Japonica | 767 | 63.00% | 1.80% | 9.65% | 25.55% | NA |
| Tropical Japonica | 504 | 15.10% | 19.00% | 15.87% | 50.00% | NA |
| Japonica Intermediate | 241 | 27.00% | 19.90% | 9.13% | 43.98% | NA |
| VI/Aromatic | 96 | 91.70% | 1.00% | 3.12% | 4.17% | NA |
| Intermediate | 90 | 53.30% | 4.40% | 13.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430779487 | G -> DEL | N | N | silent_mutation | Average:68.438; most accessible tissue: Callus, score: 87.682 | N | N | N | N |
| vg0430779487 | G -> A | LOC_Os04g51890.1 | upstream_gene_variant ; 4149.0bp to feature; MODIFIER | silent_mutation | Average:68.438; most accessible tissue: Callus, score: 87.682 | N | N | N | N |
| vg0430779487 | G -> A | LOC_Os04g51880-LOC_Os04g51890 | intergenic_region ; MODIFIER | silent_mutation | Average:68.438; most accessible tissue: Callus, score: 87.682 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430779487 | NA | 9.58E-22 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0430779487 | NA | 3.25E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 1.85E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 8.70E-09 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 1.69E-08 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 2.32E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 3.05E-08 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 8.21E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 3.49E-07 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 5.91E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 7.04E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | 6.17E-06 | 3.28E-08 | mr1446_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 3.11E-12 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 2.02E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430779487 | NA | 7.14E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |