\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430749807:

Variant ID: vg0430749807 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30749807
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAAGTGGACTCTGAAGAAAATGACAGAACAGTTTCAGAG[T/C]
TTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCAT

Reverse complement sequence

ATGCAACGAACTCGTCCCAGTGATCCCTTAGCTTTGGGAATGTGTCGAAGTTCGGTGTCTGCCCCTTCAGGATATATTTCTTGTACAGCTCTCCCTTGAA[A/G]
CTCTGAAACTGTTCTGTCATTTTCTTCAGAGTCCACTTTTTCACTTTGTCCTCTGTACCCGCGGGAAGGGTGAATGTCTCGAGCATTGTGGTCCACAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 0.80% 35.89% 10.71% NA
All Indica  2759 28.40% 1.20% 54.98% 15.40% NA
All Japonica  1512 85.30% 0.40% 9.26% 5.03% NA
Aus  269 91.80% 0.00% 7.43% 0.74% NA
Indica I  595 4.50% 2.70% 70.92% 21.85% NA
Indica II  465 76.30% 0.20% 16.13% 7.31% NA
Indica III  913 16.20% 0.20% 69.88% 13.69% NA
Indica Intermediate  786 32.30% 1.80% 48.60% 17.30% NA
Temperate Japonica  767 74.30% 0.70% 15.65% 9.39% NA
Tropical Japonica  504 97.60% 0.20% 1.79% 0.40% NA
Japonica Intermediate  241 94.60% 0.00% 4.56% 0.83% NA
VI/Aromatic  96 93.80% 0.00% 5.21% 1.04% NA
Intermediate  90 81.10% 1.10% 15.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430749807 T -> C LOC_Os04g51850.1 synonymous_variant ; p.Ser195Ser; LOW synonymous_codon Average:23.168; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0430749807 T -> DEL LOC_Os04g51850.1 N frameshift_variant Average:23.168; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430749807 NA 3.61E-18 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0430749807 NA 3.36E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 3.31E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 4.37E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 6.68E-15 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 2.18E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 8.49E-06 8.49E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.06E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.22E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 2.47E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.26E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 2.35E-09 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.41E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.56E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 3.42E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.50E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 5.31E-08 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 3.01E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.90E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 6.76E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.25E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 2.63E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 8.40E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 1.34E-09 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 4.50E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 5.95E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 9.99E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807 NA 3.41E-08 mr1923_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251