Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430749807:

Variant ID: vg0430749807 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30749807
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCTGTGGACCACAATGCTCGAGACATTCACCCTTCCCGCGGGTACAGAGGACAAAGTGAAAAAGTGGACTCTGAAGAAAATGACAGAACAGTTTCAGAG[T/C]
TTCAAGGGAGAGCTGTACAAGAAATATATCCTGAAGGGGCAGACACCGAACTTCGACACATTCCCAAAGCTAAGGGATCACTGGGACGAGTTCGTTGCAT

Reverse complement sequence

ATGCAACGAACTCGTCCCAGTGATCCCTTAGCTTTGGGAATGTGTCGAAGTTCGGTGTCTGCCCCTTCAGGATATATTTCTTGTACAGCTCTCCCTTGAA[A/G]
CTCTGAAACTGTTCTGTCATTTTCTTCAGAGTCCACTTTTTCACTTTGTCCTCTGTACCCGCGGGAAGGGTGAATGTCTCGAGCATTGTGGTCCACAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.60%	0.80%	35.89%	10.71%	NA
All Indica	2759	28.40%	1.20%	54.98%	15.40%	NA
All Japonica	1512	85.30%	0.40%	9.26%	5.03%	NA
Aus	269	91.80%	0.00%	7.43%	0.74%	NA
Indica I	595	4.50%	2.70%	70.92%	21.85%	NA
Indica II	465	76.30%	0.20%	16.13%	7.31%	NA
Indica III	913	16.20%	0.20%	69.88%	13.69%	NA
Indica Intermediate	786	32.30%	1.80%	48.60%	17.30%	NA
Temperate Japonica	767	74.30%	0.70%	15.65%	9.39%	NA
Tropical Japonica	504	97.60%	0.20%	1.79%	0.40%	NA
Japonica Intermediate	241	94.60%	0.00%	4.56%	0.83%	NA
VI/Aromatic	96	93.80%	0.00%	5.21%	1.04%	NA
Intermediate	90	81.10%	1.10%	15.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430749807	T -> C	LOC_Os04g51850.1	synonymous_variant ; p.Ser195Ser; LOW	synonymous_codon	Average:23.168; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0430749807	T -> DEL	LOC_Os04g51850.1	N	frameshift_variant	Average:23.168; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430749807	NA	3.61E-18	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0430749807	NA	3.36E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	3.31E-06	mr1081	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	4.37E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	6.68E-15	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	2.18E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	8.49E-06	8.49E-06	mr1609	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.06E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.22E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	2.47E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.26E-06	mr1291_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	2.35E-09	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.41E-06	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.56E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	3.42E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.50E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	5.31E-08	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	3.01E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.90E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	6.76E-08	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.25E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	2.63E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	8.40E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	1.34E-09	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	4.50E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	5.95E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	9.99E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430749807	NA	3.41E-08	mr1923_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251