\
| Variant ID: vg0430723225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30723225 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 113. )
TATATATGTGTTCTCAACGATTTAAAAGCAAAGATTGAAAATAAATTTCGATTCAAAATCACAAAATCAACTCCAAATTAAGATTGAAAATTTAAATTTT[G/A]
ATTGATAAGTATAACCATGTATAAGCGAAACAATGATGCTTATATTACTTTGGGAATCTTGTAGTTTTTTACCAAGCTCTTTTCACGTGGTAATGTCGGC
GCCGACATTACCACGTGAAAAGAGCTTGGTAAAAAACTACAAGATTCCCAAAGTAATATAAGCATCATTGTTTCGCTTATACATGGTTATACTTATCAAT[C/T]
AAAATTTAAATTTTCAATCTTAATTTGGAGTTGATTTTGTGATTTTGAATCGAAATTTATTTTCAATCTTTGCTTTTAAATCGTTGAGAACACATATATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.20% | 34.20% | 0.32% | 0.30% | NA |
| All Indica | 2759 | 87.70% | 11.50% | 0.33% | 0.40% | NA |
| All Japonica | 1512 | 38.00% | 61.60% | 0.20% | 0.20% | NA |
| Aus | 269 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.80% | 0.17% | 0.17% | NA |
| Indica II | 465 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.20% | 12.90% | 0.33% | 0.55% | NA |
| Indica Intermediate | 786 | 84.90% | 13.90% | 0.64% | 0.64% | NA |
| Temperate Japonica | 767 | 62.70% | 37.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 7.50% | 91.90% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 22.80% | 76.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 40.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430723225 | G -> DEL | N | N | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51809.1 | downstream_gene_variant ; 4927.0bp to feature; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51820.2 | downstream_gene_variant ; 1019.0bp to feature; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51809.3 | downstream_gene_variant ; 4927.0bp to feature; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51809.2 | downstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51820.1 | downstream_gene_variant ; 1019.0bp to feature; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51820.3 | downstream_gene_variant ; 1019.0bp to feature; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| vg0430723225 | G -> A | LOC_Os04g51809-LOC_Os04g51820 | intergenic_region ; MODIFIER | silent_mutation | Average:60.677; most accessible tissue: Callus, score: 91.358 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430723225 | NA | 3.00E-08 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 1.20E-09 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 3.97E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 2.29E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 8.44E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 4.23E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | 4.46E-06 | 3.04E-19 | mr1530_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 1.67E-12 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 4.00E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430723225 | NA | 2.37E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |