\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430723225:

Variant ID: vg0430723225 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30723225
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TATATATGTGTTCTCAACGATTTAAAAGCAAAGATTGAAAATAAATTTCGATTCAAAATCACAAAATCAACTCCAAATTAAGATTGAAAATTTAAATTTT[G/A]
ATTGATAAGTATAACCATGTATAAGCGAAACAATGATGCTTATATTACTTTGGGAATCTTGTAGTTTTTTACCAAGCTCTTTTCACGTGGTAATGTCGGC

Reverse complement sequence

GCCGACATTACCACGTGAAAAGAGCTTGGTAAAAAACTACAAGATTCCCAAAGTAATATAAGCATCATTGTTTCGCTTATACATGGTTATACTTATCAAT[C/T]
AAAATTTAAATTTTCAATCTTAATTTGGAGTTGATTTTGTGATTTTGAATCGAAATTTATTTTCAATCTTTGCTTTTAAATCGTTGAGAACACATATATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.20% 0.32% 0.30% NA
All Indica  2759 87.70% 11.50% 0.33% 0.40% NA
All Japonica  1512 38.00% 61.60% 0.20% 0.20% NA
Aus  269 12.30% 87.70% 0.00% 0.00% NA
Indica I  595 97.80% 1.80% 0.17% 0.17% NA
Indica II  465 82.80% 17.20% 0.00% 0.00% NA
Indica III  913 86.20% 12.90% 0.33% 0.55% NA
Indica Intermediate  786 84.90% 13.90% 0.64% 0.64% NA
Temperate Japonica  767 62.70% 37.00% 0.26% 0.00% NA
Tropical Japonica  504 7.50% 91.90% 0.20% 0.40% NA
Japonica Intermediate  241 22.80% 76.80% 0.00% 0.41% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430723225 G -> DEL N N silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51809.1 downstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51820.2 downstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51809.3 downstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51809.2 downstream_gene_variant ; 998.0bp to feature; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51820.1 downstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51820.3 downstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N
vg0430723225 G -> A LOC_Os04g51809-LOC_Os04g51820 intergenic_region ; MODIFIER silent_mutation Average:60.677; most accessible tissue: Callus, score: 91.358 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430723225 NA 3.00E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 1.20E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 3.97E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 2.29E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 8.44E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 4.23E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 4.46E-06 3.04E-19 mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 1.67E-12 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 4.00E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430723225 NA 2.37E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251