Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430673937:

Variant ID: vg0430673937 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30673937
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 390. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGGCAAGAACACACACACAAAACTCCCGCGAACATAGGAATGAACACCATCTTGTTTGGTGCTGCTAACTAGGCAGCTTTTTCCCGACTCTTGTATTG[C/T]
TTAAATATGCGATTACAAGGAAAGGAAATTATAGCCTCCAATCAGGCCGAAACATGCATGATCACACAATGGATATGTAACTAACCAAATAAAACAAACA

Reverse complement sequence

TGTTTGTTTTATTTGGTTAGTTACATATCCATTGTGTGATCATGCATGTTTCGGCCTGATTGGAGGCTATAATTTCCTTTCCTTGTAATCGCATATTTAA[G/A]
CAATACAAGAGTCGGGAAAAAGCTGCCTAGTTAGCAGCACCAAACAAGATGGTGTTCATTCCTATGTTCGCGGGAGTTTTGTGTGTGTGTTCTTGCCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 3.90% 0.57% 0.83% NA
All Indica  2759 98.90% 0.10% 0.43% 0.62% NA
All Japonica  1512 86.00% 11.70% 0.99% 1.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 98.50% 0.00% 0.22% 1.29% NA
Indica III  913 98.70% 0.10% 0.44% 0.77% NA
Indica Intermediate  786 98.90% 0.00% 0.64% 0.51% NA
Temperate Japonica  767 76.90% 21.60% 1.17% 0.26% NA
Tropical Japonica  504 95.00% 0.80% 0.99% 3.17% NA
Japonica Intermediate  241 96.30% 2.90% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430673937 C -> DEL N N silent_mutation Average:50.009; most accessible tissue: Zhenshan97 flag leaf, score: 95.136 N N N N
vg0430673937 C -> T LOC_Os04g51750.1 upstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:50.009; most accessible tissue: Zhenshan97 flag leaf, score: 95.136 N N N N
vg0430673937 C -> T LOC_Os04g51760.1 upstream_gene_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:50.009; most accessible tissue: Zhenshan97 flag leaf, score: 95.136 N N N N
vg0430673937 C -> T LOC_Os04g51770.1 downstream_gene_variant ; 4869.0bp to feature; MODIFIER silent_mutation Average:50.009; most accessible tissue: Zhenshan97 flag leaf, score: 95.136 N N N N
vg0430673937 C -> T LOC_Os04g51770.2 downstream_gene_variant ; 4869.0bp to feature; MODIFIER silent_mutation Average:50.009; most accessible tissue: Zhenshan97 flag leaf, score: 95.136 N N N N
vg0430673937 C -> T LOC_Os04g51760-LOC_Os04g51770 intergenic_region ; MODIFIER silent_mutation Average:50.009; most accessible tissue: Zhenshan97 flag leaf, score: 95.136 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430673937 C T 0.02 -0.03 -0.04 -0.02 -0.03 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430673937 2.80E-06 3.81E-06 mr1100 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673937 NA 6.72E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673937 NA 3.72E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673937 1.63E-07 3.66E-07 mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673937 9.01E-06 7.50E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673937 1.43E-06 9.14E-06 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673937 2.38E-08 2.48E-08 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251