Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430673719:

Variant ID: vg0430673719 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30673719
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGTGGAGAAGAGAAGTGTGCAGCTGACGGCCCCAGATGACCGCGTCGAGAACGACAAGCTCGGCACCGCCGAGGAGGAGCTCGTCTCCAAGGCGGAAG[C/T]
GGCAGCGGCTGATGTCGGAGCGTCCATTGGAAAAGTCGGCGCCGCGTCTGCCGTTGAGAACACCTCCGGCCGTCAAGGCGAAGGGCTCACGGTGAACACA

Reverse complement sequence

TGTGTTCACCGTGAGCCCTTCGCCTTGACGGCCGGAGGTGTTCTCAACGGCAGACGCGGCGCCGACTTTTCCAATGGACGCTCCGACATCAGCCGCTGCC[G/A]
CTTCCGCCTTGGAGACGAGCTCCTCCTCGGCGGTGCCGAGCTTGTCGTTCTCGACGCGGTCATCTGGGGCCGTCAGCTGCACACTTCTCTTCTCCACGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 5.00% 3.81% 8.38% NA
All Indica  2759 91.60% 0.20% 2.10% 6.16% NA
All Japonica  1512 69.00% 14.60% 4.76% 11.64% NA
Aus  269 94.80% 1.10% 2.60% 1.49% NA
Indica I  595 98.00% 0.70% 0.17% 1.18% NA
Indica II  465 87.50% 0.00% 1.29% 11.18% NA
Indica III  913 88.50% 0.00% 4.27% 7.23% NA
Indica Intermediate  786 92.60% 0.10% 1.53% 5.73% NA
Temperate Japonica  767 70.00% 26.90% 1.17% 1.96% NA
Tropical Japonica  504 64.30% 0.80% 10.32% 24.60% NA
Japonica Intermediate  241 75.50% 4.60% 4.56% 15.35% NA
VI/Aromatic  96 20.80% 4.20% 38.54% 36.46% NA
Intermediate  90 80.00% 1.10% 6.67% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430673719 C -> DEL LOC_Os04g51760.1 N frameshift_variant Average:50.288; most accessible tissue: Zhenshan97 flag leaf, score: 96.666 N N N N
vg0430673719 C -> T LOC_Os04g51760.1 missense_variant ; p.Arg57His; MODERATE nonsynonymous_codon ; R57H Average:50.288; most accessible tissue: Zhenshan97 flag leaf, score: 96.666 benign 0.109 TOLERATED 0.15

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430673719 C T -0.08 -0.08 -0.1 -0.05 -0.06 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430673719 3.16E-06 NA mr1758 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430673719 NA 2.75E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251