\
| Variant ID: vg0430646747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30646747 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, C: 0.17, others allele: 0.00, population size: 103. )
ACCCGATGAGGGTTACGACAGATTGGTTTAGGTTTTCTCGATTAAGATGTAAATTTTTTAAACTGTGAAATATTATGTTTTTAAAATAAAACTTTTTTAA[C/A]
TATCAAATAAATCTATCTTTTAAATTTATAATAATTATAACTCAATTAATTACACACGGTTGGTTTTCTCGTTTTGCATGCTCTGACTTCATTTTTAATC
GATTAAAAATGAAGTCAGAGCATGCAAAACGAGAAAACCAACCGTGTGTAATTAATTGAGTTATAATTATTATAAATTTAAAAGATAGATTTATTTGATA[G/T]
TTAAAAAAGTTTTATTTTAAAAACATAATATTTCACAGTTTAAAAAATTTACATCTTAATCGAGAAAACCTAAACCAATCTGTCGTAACCCTCATCGGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 25.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 41.60% | 58.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 31.40% | 68.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 61.70% | 38.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.00% | 67.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430646747 | C -> A | LOC_Os04g51710.1 | upstream_gene_variant ; 902.0bp to feature; MODIFIER | silent_mutation | Average:53.052; most accessible tissue: Callus, score: 83.984 | N | N | N | N |
| vg0430646747 | C -> A | LOC_Os04g51720.1 | upstream_gene_variant ; 2440.0bp to feature; MODIFIER | silent_mutation | Average:53.052; most accessible tissue: Callus, score: 83.984 | N | N | N | N |
| vg0430646747 | C -> A | LOC_Os04g51710-LOC_Os04g51720 | intergenic_region ; MODIFIER | silent_mutation | Average:53.052; most accessible tissue: Callus, score: 83.984 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430646747 | 1.33E-15 | 1.16E-47 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 4.57E-06 | 5.56E-08 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 3.26E-06 | NA | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 1.84E-09 | NA | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 3.09E-07 | 1.08E-18 | mr1167_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 1.66E-07 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 2.80E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 1.91E-07 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 4.74E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 1.40E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 3.27E-08 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 3.58E-07 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 5.34E-06 | NA | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 3.97E-24 | 1.22E-59 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 6.23E-09 | 5.58E-12 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | 1.56E-06 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 1.61E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 3.73E-10 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430646747 | NA | 4.41E-14 | mr1950_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |