\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430641254:

Variant ID: vg0430641254 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30641254
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTCTACTACTAAAGAGTTAGGCCTCTTAATTAAGATCACCTTACATGCAACTGGTGCAATGAAGAAATTTCGAAGAAAAAGAAAAACTGAACATACC[A/T]
TAGGTTTGCTTCTCTTCGATGGCAATAACCACATCATTAAAAGATTTTCTTCTTCTGAAATACTGCATGAATGTGAAAAGGAGGAATTTTAATAGATATA

Reverse complement sequence

TATATCTATTAAAATTCCTCCTTTTCACATTCATGCAGTATTTCAGAAGAAGAAAATCTTTTAATGATGTGGTTATTGCCATCGAAGAGAAGCAAACCTA[T/A]
GGTATGTTCAGTTTTTCTTTTTCTTCGAAATTTCTTCATTGCACCAGTTGCATGTAAGGTGATCTTAATTAAGAGGCCTAACTCTTTAGTAGTAGAATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 30.20% 0.04% 0.00% NA
All Indica  2759 97.10% 2.90% 0.00% 0.00% NA
All Japonica  1512 26.50% 73.50% 0.00% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.30% 0.00% 0.00% NA
Temperate Japonica  767 3.30% 96.70% 0.00% 0.00% NA
Tropical Japonica  504 61.10% 38.90% 0.00% 0.00% NA
Japonica Intermediate  241 27.80% 72.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430641254 A -> T LOC_Os04g51700.1 upstream_gene_variant ; 2454.0bp to feature; MODIFIER silent_mutation Average:65.118; most accessible tissue: Callus, score: 88.755 N N N N
vg0430641254 A -> T LOC_Os04g51710.1 downstream_gene_variant ; 842.0bp to feature; MODIFIER silent_mutation Average:65.118; most accessible tissue: Callus, score: 88.755 N N N N
vg0430641254 A -> T LOC_Os04g51700-LOC_Os04g51710 intergenic_region ; MODIFIER silent_mutation Average:65.118; most accessible tissue: Callus, score: 88.755 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430641254 1.77E-09 5.14E-39 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 2.97E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 4.45E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 1.06E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 4.66E-06 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 5.36E-09 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 2.81E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 2.45E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 2.80E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 9.57E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 7.14E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 2.91E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 4.41E-19 1.45E-52 mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 1.57E-08 8.71E-07 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430641254 NA 4.74E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251