\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430628468:

Variant ID: vg0430628468 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30628468
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.22, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCCGGTAAATAACCACTTGGTCATTAGAGCAGGTATAATAGCATATGCTATAAACCAGCTGTAAACATATTTTAAGGAGATAAATAAAGAGAAAGAAT[A/G]
ACAGCGCGCTACAGATTTATAGCTAGCTGCAGCACGGACTCCAAGACGCAAGGTGTGTATGACAGGTGAGACCAGGTATTAATAGTGTACTATTTTACTA

Reverse complement sequence

TAGTAAAATAGTACACTATTAATACCTGGTCTCACCTGTCATACACACCTTGCGTCTTGGAGTCCGTGCTGCAGCTAGCTATAAATCTGTAGCGCGCTGT[T/C]
ATTCTTTCTCTTTATTTATCTCCTTAAAATATGTTTACAGCTGGTTTATAGCATATGCTATTATACCTGCTCTAATGACCAAGTGGTTATTTACCGGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 25.20% 0.38% 0.00% NA
All Indica  2759 97.10% 2.80% 0.11% 0.00% NA
All Japonica  1512 40.40% 58.60% 0.99% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 29.60% 68.80% 1.56% 0.00% NA
Tropical Japonica  504 62.10% 37.70% 0.20% 0.00% NA
Japonica Intermediate  241 29.50% 69.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430628468 A -> G LOC_Os04g51690.1 upstream_gene_variant ; 96.0bp to feature; MODIFIER silent_mutation Average:96.097; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0430628468 A -> G LOC_Os04g51700.1 downstream_gene_variant ; 1178.0bp to feature; MODIFIER silent_mutation Average:96.097; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N
vg0430628468 A -> G LOC_Os04g51690-LOC_Os04g51700 intergenic_region ; MODIFIER silent_mutation Average:96.097; most accessible tissue: Zhenshan97 root, score: 97.309 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430628468 A G 0.07 0.07 0.05 0.03 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430628468 2.22E-16 6.46E-48 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 2.28E-06 2.78E-08 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 1.87E-06 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 1.40E-10 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 8.94E-07 NA mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 1.85E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 9.26E-06 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 5.10E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 1.47E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 5.75E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 9.05E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 2.84E-08 mr1677_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 1.60E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 1.05E-07 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 6.25E-06 NA mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 1.07E-25 2.07E-60 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 3.61E-09 4.31E-12 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 8.16E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 7.80E-07 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 2.90E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430628468 NA 7.53E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251