Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430612192:

Variant ID: vg0430612192 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30612192
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGGGACTATAATGAAAAAATTGAAGGGGGGGCTTAGGGGGGTATCCATGGGTTTTGTGGGTGTAGGGGGGACTTGAGTCCCCCCTGCACCCACGTTG[T/G]
ATCCGCCCCTGTCAGTCACGTAGATAACTTGTATCAGTTGCTTGATGATTTGCTACGGATAATATGCACAAATTTGACTCGTTCCCAACTCTTCGAACTT

Reverse complement sequence

AAGTTCGAAGAGTTGGGAACGAGTCAAATTTGTGCATATTATCCGTAGCAAATCATCAAGCAACTGATACAAGTTATCTACGTGACTGACAGGGGCGGAT[A/C]
CAACGTGGGTGCAGGGGGGACTCAAGTCCCCCCTACACCCACAAAACCCATGGATACCCCCCTAAGCCCCCCCTTCAATTTTTTCATTATAGTCCCCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 37.40% 0.42% 12.23% NA
All Indica  2759 36.10% 61.30% 0.47% 2.14% NA
All Japonica  1512 78.40% 1.10% 0.26% 20.30% NA
Aus  269 13.00% 10.40% 0.37% 76.21% NA
Indica I  595 55.50% 43.00% 0.67% 0.84% NA
Indica II  465 25.20% 73.80% 0.22% 0.86% NA
Indica III  913 34.80% 63.10% 0.55% 1.53% NA
Indica Intermediate  786 29.40% 65.60% 0.38% 4.58% NA
Temperate Japonica  767 95.30% 0.10% 0.13% 4.43% NA
Tropical Japonica  504 66.30% 1.40% 0.60% 31.75% NA
Japonica Intermediate  241 49.80% 3.30% 0.00% 46.89% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 57.80% 32.20% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430612192 T -> DEL N N silent_mutation Average:86.108; most accessible tissue: Minghui63 root, score: 98.204 N N N N
vg0430612192 T -> G LOC_Os04g51660.1 upstream_gene_variant ; 1786.0bp to feature; MODIFIER silent_mutation Average:86.108; most accessible tissue: Minghui63 root, score: 98.204 N N N N
vg0430612192 T -> G LOC_Os04g51650.1 downstream_gene_variant ; 4238.0bp to feature; MODIFIER silent_mutation Average:86.108; most accessible tissue: Minghui63 root, score: 98.204 N N N N
vg0430612192 T -> G LOC_Os04g51680.1 downstream_gene_variant ; 3768.0bp to feature; MODIFIER silent_mutation Average:86.108; most accessible tissue: Minghui63 root, score: 98.204 N N N N
vg0430612192 T -> G LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:86.108; most accessible tissue: Minghui63 root, score: 98.204 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430612192 T G 0.04 0.06 0.03 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430612192 1.07E-06 NA mr1064 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 8.89E-06 2.87E-10 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 5.86E-10 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 2.18E-09 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 1.06E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 1.31E-07 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 2.91E-07 NA mr1534 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 1.17E-06 3.48E-11 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 5.79E-12 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 9.05E-10 5.33E-14 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 3.10E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 4.92E-08 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 1.48E-09 2.06E-14 mr1064_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 1.27E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 5.29E-19 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 8.06E-18 9.06E-27 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 5.31E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430612192 NA 4.04E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251