\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430611390:

Variant ID: vg0430611390 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 30611390
Reference Allele: AAlternative Allele: C,ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATATAACCATGGTATTCC,ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATAAAACCATGGTATTCC,T,ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCTATATAACCATGGTATTCC
Primary Allele: CSecondary Allele: ACTTCTAGGCCCATTGTATT GCTTCGCCGGCCCATATAAC CATGGTATTCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATAAGTTACAGTGTAATTACACTAAGATTGTACTATAATTACATCTGTCAAATTTTTAGTAGAAAATTTGTCGACAAATGTATAGGTGGTCCCATTC[A/C,ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATATAACCATGGTATTCC,ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATAAAACCATGGTATTCC,T,ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCTATATAACCATGGTATTCC]
TTCTTAAGATTAAAACAAAGGCCCGGAGGGCCTAATCCTAATGATGTAGAGATTAATGATACTGTGCTAAGTTTTGCAAGGGAACACAGAGACATTTGCT

Reverse complement sequence

AGCAAATGTCTCTGTGTTCCCTTGCAAAACTTAGCACAGTATCATTAATCTCTACATCATTAGGATTAGGCCCTCCGGGCCTTTGTTTTAATCTTAAGAA[T/G,GGAATACCATGGTTATATGGGCCGGCGAAGCAATACAATGGGCCTAGAAGT,GGAATACCATGGTTTTATGGGCCGGCGAAGCAATACAATGGGCCTAGAAGT,A,GGAATACCATGGTTATATAGGCCGGCGAAGCAATACAATGGGCCTAGAAGT]
GAATGGGACCACCTATACATTTGTCGACAAATTTTCTACTAAAAATTTGACAGATGTAATTATAGTACAATCTTAGTGTAATTACACTGTAACTTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of ACTTCTAGGCCCATTGTATT GCTTCGCCGGCCCATATAAC CATGGTATTCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.40% 19.80% 8.19% 19.89% A: 13.48%; T: 0.13%; ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCTATATAACCATGGTATTCC: 0.02%; ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATAAAACCATGGTATTCC: 0.02%
All Indica  2759 37.80% 32.50% 13.12% 14.57% A: 1.74%; T: 0.22%; ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCTATATAACCATGGTATTCC: 0.04%; ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATAAAACCATGGTATTCC: 0.04%
All Japonica  1512 40.10% 0.70% 0.93% 20.44% A: 37.83%
Aus  269 13.00% 5.90% 2.60% 78.44% NA
Indica I  595 55.30% 18.50% 15.63% 9.24% A: 1.34%
Indica II  465 24.10% 40.90% 15.27% 15.27% A: 3.66%; T: 0.65%; ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCCATAAAACCATGGTATTCC: 0.22%
Indica III  913 38.90% 35.80% 8.65% 14.90% A: 1.42%; T: 0.22%; ACTTCTAGGCCCATTGTATTGCTTCGCCGGCCTATATAACCATGGTATTCC: 0.11%
Indica Intermediate  786 31.30% 34.40% 15.14% 17.81% A: 1.27%; T: 0.13%
Temperate Japonica  767 30.80% 0.10% 1.17% 4.43% A: 63.49%
Tropical Japonica  504 60.30% 1.00% 0.40% 31.94% A: 6.35%
Japonica Intermediate  241 27.40% 2.10% 1.24% 47.30% A: 21.99%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 43.30% 13.30% 4.44% 20.00% A: 18.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATATAACCATGGTATTCC LOC_Os04g51640.1 upstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATATAACCATGGTATTCC LOC_Os04g51660.1 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATATAACCATGGTATTCC LOC_Os04g51650.1 downstream_gene_variant ; 3437.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATATAACCATGGTATTCC LOC_Os04g51680.1 downstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATATAACCATGGTATTCC LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> DEL N N silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATAAAACCATGGTATTCC LOC_Os04g51640.1 upstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATAAAACCATGGTATTCC LOC_Os04g51660.1 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATAAAACCATGGTATTCC LOC_Os04g51650.1 downstream_gene_variant ; 3437.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATAAAACCATGGTATTCC LOC_Os04g51680.1 downstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCCATAAAACCATGGTATTCC LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> C LOC_Os04g51640.1 upstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> C LOC_Os04g51660.1 upstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> C LOC_Os04g51650.1 downstream_gene_variant ; 3436.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> C LOC_Os04g51680.1 downstream_gene_variant ; 4570.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> C LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCTATATAACCATGGTATTCC LOC_Os04g51640.1 upstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCTATATAACCATGGTATTCC LOC_Os04g51660.1 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCTATATAACCATGGTATTCC LOC_Os04g51650.1 downstream_gene_variant ; 3437.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCTATATAACCATGGTATTCC LOC_Os04g51680.1 downstream_gene_variant ; 4569.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> ACTTCTAGGCCCATTGTATTGCTTCGCCGG CCTATATAACCATGGTATTCC LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> T LOC_Os04g51640.1 upstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> T LOC_Os04g51660.1 upstream_gene_variant ; 984.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> T LOC_Os04g51650.1 downstream_gene_variant ; 3436.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> T LOC_Os04g51680.1 downstream_gene_variant ; 4570.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N
vg0430611390 A -> T LOC_Os04g51660-LOC_Os04g51680 intergenic_region ; MODIFIER silent_mutation Average:63.607; most accessible tissue: Zhenshan97 root, score: 91.211 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430611390 A ACTTC* 0.78 1.09 0.82 0.26 0.57 0.88
vg0430611390 A C -0.04 -0.02 -0.01 -0.01 -0.02 0.0
vg0430611390 A T -0.04 -0.03 -0.03 -0.02 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430611390 NA 3.62E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 5.66E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 8.55E-06 mr1535 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 3.41E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 6.97E-06 mr1675 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 2.56E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 8.87E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 3.03E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 2.06E-06 5.15E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 2.93E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 1.46E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 1.39E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 6.89E-14 mr1282_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 2.75E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 9.26E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 5.08E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 5.71E-06 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 3.27E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 8.62E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 2.32E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611390 NA 1.92E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251