\
| Variant ID: vg0430611294 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30611294 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACCAGAACAAATCTTGTAATAGATCTAACGATTCAAAATTACGTGAAACTTACATGCAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTATATA[T/C]
AAGTTACAGTGTAATTACACTAAGATTGTACTATAATTACATCTGTCAAATTTTTAGTAGAAAATTTGTCGACAAATGTATAGGTGGTCCCATTCATTCT
AGAATGAATGGGACCACCTATACATTTGTCGACAAATTTTCTACTAAAAATTTGACAGATGTAATTATAGTACAATCTTAGTGTAATTACACTGTAACTT[A/G]
TATATAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGCATGTAAGTTTCACGTAATTTTGAATCGTTAGATCTATTACAAGATTTGTTCTGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 37.30% | 0.83% | 11.72% | NA |
| All Indica | 2759 | 36.10% | 61.30% | 0.94% | 1.63% | NA |
| All Japonica | 1512 | 78.60% | 1.00% | 0.46% | 19.97% | NA |
| Aus | 269 | 15.20% | 8.90% | 1.49% | 74.35% | NA |
| Indica I | 595 | 55.30% | 42.90% | 1.51% | 0.34% | NA |
| Indica II | 465 | 25.20% | 73.80% | 0.00% | 1.08% | NA |
| Indica III | 913 | 34.70% | 63.40% | 1.10% | 0.77% | NA |
| Indica Intermediate | 786 | 29.60% | 65.50% | 0.89% | 3.94% | NA |
| Temperate Japonica | 767 | 95.30% | 0.10% | 0.13% | 4.43% | NA |
| Tropical Japonica | 504 | 66.70% | 1.40% | 0.40% | 31.55% | NA |
| Japonica Intermediate | 241 | 50.20% | 2.90% | 1.66% | 45.23% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 32.20% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430611294 | T -> C | LOC_Os04g51640.1 | upstream_gene_variant ; 4463.0bp to feature; MODIFIER | silent_mutation | Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472 | N | N | N | N |
| vg0430611294 | T -> C | LOC_Os04g51660.1 | upstream_gene_variant ; 888.0bp to feature; MODIFIER | silent_mutation | Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472 | N | N | N | N |
| vg0430611294 | T -> C | LOC_Os04g51650.1 | downstream_gene_variant ; 3340.0bp to feature; MODIFIER | silent_mutation | Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472 | N | N | N | N |
| vg0430611294 | T -> C | LOC_Os04g51680.1 | downstream_gene_variant ; 4666.0bp to feature; MODIFIER | silent_mutation | Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472 | N | N | N | N |
| vg0430611294 | T -> C | LOC_Os04g51660-LOC_Os04g51680 | intergenic_region ; MODIFIER | silent_mutation | Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472 | N | N | N | N |
| vg0430611294 | T -> DEL | N | N | silent_mutation | Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430611294 | 3.56E-06 | NA | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | NA | 1.13E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 5.08E-06 | NA | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 3.08E-06 | NA | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 3.40E-14 | 1.18E-45 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 1.71E-06 | 6.99E-09 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | NA | 3.09E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 3.17E-06 | NA | mr1969 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 3.53E-08 | NA | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 2.67E-06 | NA | mr1167_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | NA | 1.26E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | NA | 1.65E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | NA | 7.26E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 1.31E-20 | 2.89E-58 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430611294 | 4.98E-11 | 1.48E-14 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |