Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430611294:

Variant ID: vg0430611294 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30611294
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCAGAACAAATCTTGTAATAGATCTAACGATTCAAAATTACGTGAAACTTACATGCAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTATATA[T/C]
AAGTTACAGTGTAATTACACTAAGATTGTACTATAATTACATCTGTCAAATTTTTAGTAGAAAATTTGTCGACAAATGTATAGGTGGTCCCATTCATTCT

Reverse complement sequence

AGAATGAATGGGACCACCTATACATTTGTCGACAAATTTTCTACTAAAAATTTGACAGATGTAATTATAGTACAATCTTAGTGTAATTACACTGTAACTT[A/G]
TATATAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGCATGTAAGTTTCACGTAATTTTGAATCGTTAGATCTATTACAAGATTTGTTCTGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	37.30%	0.83%	11.72%	NA
All Indica	2759	36.10%	61.30%	0.94%	1.63%	NA
All Japonica	1512	78.60%	1.00%	0.46%	19.97%	NA
Aus	269	15.20%	8.90%	1.49%	74.35%	NA
Indica I	595	55.30%	42.90%	1.51%	0.34%	NA
Indica II	465	25.20%	73.80%	0.00%	1.08%	NA
Indica III	913	34.70%	63.40%	1.10%	0.77%	NA
Indica Intermediate	786	29.60%	65.50%	0.89%	3.94%	NA
Temperate Japonica	767	95.30%	0.10%	0.13%	4.43%	NA
Tropical Japonica	504	66.70%	1.40%	0.40%	31.55%	NA
Japonica Intermediate	241	50.20%	2.90%	1.66%	45.23%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	32.20%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430611294	T -> C	LOC_Os04g51640.1	upstream_gene_variant ; 4463.0bp to feature; MODIFIER	silent_mutation	Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611294	T -> C	LOC_Os04g51660.1	upstream_gene_variant ; 888.0bp to feature; MODIFIER	silent_mutation	Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611294	T -> C	LOC_Os04g51650.1	downstream_gene_variant ; 3340.0bp to feature; MODIFIER	silent_mutation	Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611294	T -> C	LOC_Os04g51680.1	downstream_gene_variant ; 4666.0bp to feature; MODIFIER	silent_mutation	Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611294	T -> C	LOC_Os04g51660-LOC_Os04g51680	intergenic_region ; MODIFIER	silent_mutation	Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N
vg0430611294	T -> DEL	N	N	silent_mutation	Average:60.962; most accessible tissue: Zhenshan97 root, score: 90.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430611294	3.56E-06	NA	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	NA	1.13E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	5.08E-06	NA	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	3.08E-06	NA	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	3.40E-14	1.18E-45	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	1.71E-06	6.99E-09	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	NA	3.09E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	3.17E-06	NA	mr1969	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	3.53E-08	NA	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	2.67E-06	NA	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	NA	1.26E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	NA	1.65E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	NA	7.26E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	1.31E-20	2.89E-58	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430611294	4.98E-11	1.48E-14	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251