Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430608671:

Variant ID: vg0430608671 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30608671
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTACCAATTCTGATTTGTTCGCATTCATTTGTTATGTATTCAAATTCATAGATTAGGATGTGTCACATGTGATATTATGTTGCTATATTTTAGGACAAAC[G/A]
TATGGAATCCCTATTTGACAAATGTTTCATGTTTGTCTAGAGAATTACATTATCATTGTGAAAGGTCTAATTTAGTTCTATACGAACACTAATGGAAGAT

Reverse complement sequence

ATCTTCCATTAGTGTTCGTATAGAACTAAATTAGACCTTTCACAATGATAATGTAATTCTCTAGACAAACATGAAACATTTGTCAAATAGGGATTCCATA[C/T]
GTTTGTCCTAAAATATAGCAACATAATATCACATGTGACACATCCTAATCTATGAATTTGAATACATAACAAATGAATGCGAACAAATCAGAATTGGTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	12.10%	0.00%	0.00%	NA
All Indica	2759	98.30%	1.70%	0.00%	0.00%	NA
All Japonica	1512	79.40%	20.60%	0.00%	0.00%	NA
Aus	269	23.00%	77.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.90%	0.00%	0.00%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	67.90%	32.10%	0.00%	0.00%	NA
Japonica Intermediate	241	52.70%	47.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430608671	G -> A	LOC_Os04g51640.1	upstream_gene_variant ; 1840.0bp to feature; MODIFIER	silent_mutation	Average:61.351; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N
vg0430608671	G -> A	LOC_Os04g51650.1	downstream_gene_variant ; 717.0bp to feature; MODIFIER	silent_mutation	Average:61.351; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N
vg0430608671	G -> A	LOC_Os04g51660.1	downstream_gene_variant ; 94.0bp to feature; MODIFIER	silent_mutation	Average:61.351; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N
vg0430608671	G -> A	LOC_Os04g51650-LOC_Os04g51660	intergenic_region ; MODIFIER	silent_mutation	Average:61.351; most accessible tissue: Minghui63 root, score: 89.995	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430608671	2.33E-11	NA	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	3.35E-10	mr1064	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	1.36E-09	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	3.81E-06	5.58E-12	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	1.81E-11	NA	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	1.56E-06	2.37E-11	mr1534	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	9.22E-30	3.70E-54	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	2.29E-14	2.13E-19	mr1745	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	2.46E-08	NA	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	1.63E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	7.54E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	1.10E-12	NA	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	7.02E-07	2.45E-11	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	1.14E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	1.82E-09	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	8.59E-25	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	5.02E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	8.80E-07	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	2.41E-07	4.39E-13	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	7.03E-06	NA	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	8.78E-42	1.39E-58	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	7.03E-20	1.85E-29	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	7.56E-11	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671	NA	8.31E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251