\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430608671:

Variant ID: vg0430608671 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30608671
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTACCAATTCTGATTTGTTCGCATTCATTTGTTATGTATTCAAATTCATAGATTAGGATGTGTCACATGTGATATTATGTTGCTATATTTTAGGACAAAC[G/A]
TATGGAATCCCTATTTGACAAATGTTTCATGTTTGTCTAGAGAATTACATTATCATTGTGAAAGGTCTAATTTAGTTCTATACGAACACTAATGGAAGAT

Reverse complement sequence

ATCTTCCATTAGTGTTCGTATAGAACTAAATTAGACCTTTCACAATGATAATGTAATTCTCTAGACAAACATGAAACATTTGTCAAATAGGGATTCCATA[C/T]
GTTTGTCCTAAAATATAGCAACATAATATCACATGTGACACATCCTAATCTATGAATTTGAATACATAACAAATGAATGCGAACAAATCAGAATTGGTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.10% 0.00% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 79.40% 20.60% 0.00% 0.00% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 67.90% 32.10% 0.00% 0.00% NA
Japonica Intermediate  241 52.70% 47.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430608671 G -> A LOC_Os04g51640.1 upstream_gene_variant ; 1840.0bp to feature; MODIFIER silent_mutation Average:61.351; most accessible tissue: Minghui63 root, score: 89.995 N N N N
vg0430608671 G -> A LOC_Os04g51650.1 downstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:61.351; most accessible tissue: Minghui63 root, score: 89.995 N N N N
vg0430608671 G -> A LOC_Os04g51660.1 downstream_gene_variant ; 94.0bp to feature; MODIFIER silent_mutation Average:61.351; most accessible tissue: Minghui63 root, score: 89.995 N N N N
vg0430608671 G -> A LOC_Os04g51650-LOC_Os04g51660 intergenic_region ; MODIFIER silent_mutation Average:61.351; most accessible tissue: Minghui63 root, score: 89.995 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430608671 2.33E-11 NA mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 3.35E-10 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 1.36E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 3.81E-06 5.58E-12 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 1.81E-11 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 1.56E-06 2.37E-11 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 9.22E-30 3.70E-54 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 2.29E-14 2.13E-19 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 2.46E-08 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 1.63E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 7.54E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 1.10E-12 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 7.02E-07 2.45E-11 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 1.14E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 1.82E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 8.59E-25 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 5.02E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 8.80E-07 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 2.41E-07 4.39E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 7.03E-06 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 8.78E-42 1.39E-58 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 7.03E-20 1.85E-29 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 7.56E-11 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430608671 NA 8.31E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251