\
| Variant ID: vg0430595523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30595523 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 100. )
GAGGCCATGAGGCCCATGACGCGACTGGAAATACTCCAGGACAGCTCGCCGGCTGCTGCTCTGCAGTGCTATATACTCTCAGGCTGTGTTTGGATAATGG[A/G]
AAATAGGGGGTGGGATTGGGATTGGGAAATGAATGAAGGGTTAGGATTAAATGAAAGAGGGAGAATGAATGGTTAGGATTTAAAGATGTCTTTTTGTGGG
CCCACAAAAAGACATCTTTAAATCCTAACCATTCATTCTCCCTCTTTCATTTAATCCTAACCCTTCATTCATTTCCCAATCCCAATCCCACCCCCTATTT[T/C]
CCATTATCCAAACACAGCCTGAGAGTATATAGCACTGCAGAGCAGCAGCCGGCGAGCTGTCCTGGAGTATTTCCAGTCGCGTCATGGGCCTCATGGCCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 37.30% | 1.93% | 10.75% | NA |
| All Indica | 2759 | 36.10% | 61.10% | 1.38% | 1.38% | NA |
| All Japonica | 1512 | 78.50% | 1.10% | 0.40% | 20.04% | NA |
| Aus | 269 | 13.80% | 10.40% | 17.10% | 58.74% | NA |
| Indica I | 595 | 55.60% | 42.50% | 1.51% | 0.34% | NA |
| Indica II | 465 | 25.20% | 73.50% | 0.65% | 0.65% | NA |
| Indica III | 913 | 34.70% | 63.60% | 0.88% | 0.77% | NA |
| Indica Intermediate | 786 | 29.50% | 64.90% | 2.29% | 3.31% | NA |
| Temperate Japonica | 767 | 95.30% | 0.10% | 0.00% | 4.56% | NA |
| Tropical Japonica | 504 | 66.50% | 1.60% | 0.60% | 31.35% | NA |
| Japonica Intermediate | 241 | 50.20% | 2.90% | 1.24% | 45.64% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 31.10% | 1.11% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430595523 | A -> DEL | N | N | silent_mutation | Average:67.268; most accessible tissue: Callus, score: 95.093 | N | N | N | N |
| vg0430595523 | A -> G | LOC_Os04g51630.1 | upstream_gene_variant ; 4394.0bp to feature; MODIFIER | silent_mutation | Average:67.268; most accessible tissue: Callus, score: 95.093 | N | N | N | N |
| vg0430595523 | A -> G | LOC_Os04g51630.2 | upstream_gene_variant ; 4394.0bp to feature; MODIFIER | silent_mutation | Average:67.268; most accessible tissue: Callus, score: 95.093 | N | N | N | N |
| vg0430595523 | A -> G | LOC_Os04g51630.3 | upstream_gene_variant ; 4447.0bp to feature; MODIFIER | silent_mutation | Average:67.268; most accessible tissue: Callus, score: 95.093 | N | N | N | N |
| vg0430595523 | A -> G | LOC_Os04g51620.1 | downstream_gene_variant ; 387.0bp to feature; MODIFIER | silent_mutation | Average:67.268; most accessible tissue: Callus, score: 95.093 | N | N | N | N |
| vg0430595523 | A -> G | LOC_Os04g51620-LOC_Os04g51630 | intergenic_region ; MODIFIER | silent_mutation | Average:67.268; most accessible tissue: Callus, score: 95.093 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430595523 | NA | 3.49E-15 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 9.55E-12 | mr1174 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 9.95E-08 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 2.68E-08 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 4.64E-13 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 4.45E-10 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 6.51E-09 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430595523 | NA | 2.16E-09 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |