\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430595523:

Variant ID: vg0430595523 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30595523
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGCCATGAGGCCCATGACGCGACTGGAAATACTCCAGGACAGCTCGCCGGCTGCTGCTCTGCAGTGCTATATACTCTCAGGCTGTGTTTGGATAATGG[A/G]
AAATAGGGGGTGGGATTGGGATTGGGAAATGAATGAAGGGTTAGGATTAAATGAAAGAGGGAGAATGAATGGTTAGGATTTAAAGATGTCTTTTTGTGGG

Reverse complement sequence

CCCACAAAAAGACATCTTTAAATCCTAACCATTCATTCTCCCTCTTTCATTTAATCCTAACCCTTCATTCATTTCCCAATCCCAATCCCACCCCCTATTT[T/C]
CCATTATCCAAACACAGCCTGAGAGTATATAGCACTGCAGAGCAGCAGCCGGCGAGCTGTCCTGGAGTATTTCCAGTCGCGTCATGGGCCTCATGGCCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 37.30% 1.93% 10.75% NA
All Indica  2759 36.10% 61.10% 1.38% 1.38% NA
All Japonica  1512 78.50% 1.10% 0.40% 20.04% NA
Aus  269 13.80% 10.40% 17.10% 58.74% NA
Indica I  595 55.60% 42.50% 1.51% 0.34% NA
Indica II  465 25.20% 73.50% 0.65% 0.65% NA
Indica III  913 34.70% 63.60% 0.88% 0.77% NA
Indica Intermediate  786 29.50% 64.90% 2.29% 3.31% NA
Temperate Japonica  767 95.30% 0.10% 0.00% 4.56% NA
Tropical Japonica  504 66.50% 1.60% 0.60% 31.35% NA
Japonica Intermediate  241 50.20% 2.90% 1.24% 45.64% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 57.80% 31.10% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430595523 A -> DEL N N silent_mutation Average:67.268; most accessible tissue: Callus, score: 95.093 N N N N
vg0430595523 A -> G LOC_Os04g51630.1 upstream_gene_variant ; 4394.0bp to feature; MODIFIER silent_mutation Average:67.268; most accessible tissue: Callus, score: 95.093 N N N N
vg0430595523 A -> G LOC_Os04g51630.2 upstream_gene_variant ; 4394.0bp to feature; MODIFIER silent_mutation Average:67.268; most accessible tissue: Callus, score: 95.093 N N N N
vg0430595523 A -> G LOC_Os04g51630.3 upstream_gene_variant ; 4447.0bp to feature; MODIFIER silent_mutation Average:67.268; most accessible tissue: Callus, score: 95.093 N N N N
vg0430595523 A -> G LOC_Os04g51620.1 downstream_gene_variant ; 387.0bp to feature; MODIFIER silent_mutation Average:67.268; most accessible tissue: Callus, score: 95.093 N N N N
vg0430595523 A -> G LOC_Os04g51620-LOC_Os04g51630 intergenic_region ; MODIFIER silent_mutation Average:67.268; most accessible tissue: Callus, score: 95.093 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430595523 NA 3.49E-15 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 9.55E-12 mr1174 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 9.95E-08 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 2.68E-08 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 4.64E-13 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 4.45E-10 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 6.51E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523 NA 2.16E-09 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251