Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430595523:

Variant ID: vg0430595523 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30595523
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGCCATGAGGCCCATGACGCGACTGGAAATACTCCAGGACAGCTCGCCGGCTGCTGCTCTGCAGTGCTATATACTCTCAGGCTGTGTTTGGATAATGG[A/G]
AAATAGGGGGTGGGATTGGGATTGGGAAATGAATGAAGGGTTAGGATTAAATGAAAGAGGGAGAATGAATGGTTAGGATTTAAAGATGTCTTTTTGTGGG

Reverse complement sequence

CCCACAAAAAGACATCTTTAAATCCTAACCATTCATTCTCCCTCTTTCATTTAATCCTAACCCTTCATTCATTTCCCAATCCCAATCCCACCCCCTATTT[T/C]
CCATTATCCAAACACAGCCTGAGAGTATATAGCACTGCAGAGCAGCAGCCGGCGAGCTGTCCTGGAGTATTTCCAGTCGCGTCATGGGCCTCATGGCCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	37.30%	1.93%	10.75%	NA
All Indica	2759	36.10%	61.10%	1.38%	1.38%	NA
All Japonica	1512	78.50%	1.10%	0.40%	20.04%	NA
Aus	269	13.80%	10.40%	17.10%	58.74%	NA
Indica I	595	55.60%	42.50%	1.51%	0.34%	NA
Indica II	465	25.20%	73.50%	0.65%	0.65%	NA
Indica III	913	34.70%	63.60%	0.88%	0.77%	NA
Indica Intermediate	786	29.50%	64.90%	2.29%	3.31%	NA
Temperate Japonica	767	95.30%	0.10%	0.00%	4.56%	NA
Tropical Japonica	504	66.50%	1.60%	0.60%	31.35%	NA
Japonica Intermediate	241	50.20%	2.90%	1.24%	45.64%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	31.10%	1.11%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430595523	A -> DEL	N	N	silent_mutation	Average:67.268; most accessible tissue: Callus, score: 95.093	N	N	N	N
vg0430595523	A -> G	LOC_Os04g51630.1	upstream_gene_variant ; 4394.0bp to feature; MODIFIER	silent_mutation	Average:67.268; most accessible tissue: Callus, score: 95.093	N	N	N	N
vg0430595523	A -> G	LOC_Os04g51630.2	upstream_gene_variant ; 4394.0bp to feature; MODIFIER	silent_mutation	Average:67.268; most accessible tissue: Callus, score: 95.093	N	N	N	N
vg0430595523	A -> G	LOC_Os04g51630.3	upstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:67.268; most accessible tissue: Callus, score: 95.093	N	N	N	N
vg0430595523	A -> G	LOC_Os04g51620.1	downstream_gene_variant ; 387.0bp to feature; MODIFIER	silent_mutation	Average:67.268; most accessible tissue: Callus, score: 95.093	N	N	N	N
vg0430595523	A -> G	LOC_Os04g51620-LOC_Os04g51630	intergenic_region ; MODIFIER	silent_mutation	Average:67.268; most accessible tissue: Callus, score: 95.093	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430595523	NA	3.49E-15	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	9.55E-12	mr1174	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	9.95E-08	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	2.68E-08	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	4.64E-13	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	4.45E-10	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	6.51E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430595523	NA	2.16E-09	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251