Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0430592103:

Variant ID: vg0430592103 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30592103
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGTAGATACATAAGAAATCATGCCAAAACTTGGTAATATTGATAAATTGTTAAAATTTTAGCATTGCCAAATTTTGGTAAGGTTCATTTTGGCTATAA[T/C]
TTGAACATGCAAAAAATAAGCGTTTTACACAAACGAGGTGGTACTAACGTGATTAATTGAGTTTTCATTATTACAAACTTAAAAAATAGATTAACCTAAT

Reverse complement sequence

ATTAGGTTAATCTATTTTTTAAGTTTGTAATAATGAAAACTCAATTAATCACGTTAGTACCACCTCGTTTGTGTAAAACGCTTATTTTTTGCATGTTCAA[A/G]
TTATAGCCAAAATGAACCTTACCAAAATTTGGCAATGCTAAAATTTTAACAATTTATCAATATTACCAAGTTTTGGCATGATTTCTTATGTATCTACGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.00% 0.04% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 79.60% 20.40% 0.07% 0.00% NA
Aus  269 23.40% 76.20% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 68.10% 31.90% 0.00% 0.00% NA
Japonica Intermediate  241 52.70% 46.90% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430592103 T -> C LOC_Os04g51620.1 upstream_gene_variant ; 2081.0bp to feature; MODIFIER silent_mutation Average:40.887; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0430592103 T -> C LOC_Os04g51610-LOC_Os04g51620 intergenic_region ; MODIFIER silent_mutation Average:40.887; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430592103 1.05E-09 NA mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 2.70E-09 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 1.75E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 2.64E-07 5.21E-13 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 1.97E-09 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 1.06E-09 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 1.33E-30 7.98E-55 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 2.54E-15 4.76E-18 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 6.57E-09 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 1.62E-09 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 9.84E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 2.36E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 4.66E-11 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 2.04E-06 3.86E-11 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 1.40E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 4.05E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 1.91E-06 3.35E-11 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 1.28E-07 9.81E-28 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 4.63E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 7.10E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 3.22E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 4.63E-09 8.75E-16 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 1.63E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 9.55E-07 4.73E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 3.79E-45 1.70E-61 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 3.03E-22 1.68E-29 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 1.37E-09 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430592103 NA 1.48E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251