Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430559445:

Variant ID: vg0430559445 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30559445
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCACATAAATTGTTTTTCTAGTGACAATTAATTCTTTTAAACTGGAGGAAGTGTGTAAATCTATTATATTATTAAAGGAATAGAAAAAGGAGCCTCCAC[G/A]
TTCGCTCTCATGGTCTAGAAATTCTCATATTAATTGGAGAAAAAGAAAAGGCAGAGTCCATATAGAAATATAATTTAGAAATAGTTGAGAAAGAAAATAG

Reverse complement sequence

CTATTTTCTTTCTCAACTATTTCTAAATTATATTTCTATATGGACTCTGCCTTTTCTTTTTCTCCAATTAATATGAGAATTTCTAGACCATGAGAGCGAA[C/T]
GTGGAGGCTCCTTTTTCTATTCCTTTAATAATATAATAGATTTACACACTTCCTCCAGTTTAAAAGAATTAATTGTCACTAGAAAAACAATTTATGTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.10% 0.11% 0.00% NA
All Indica  2759 98.30% 1.60% 0.07% 0.00% NA
All Japonica  1512 79.30% 20.60% 0.07% 0.00% NA
Aus  269 22.70% 76.60% 0.74% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.70% 0.13% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 67.70% 32.30% 0.00% 0.00% NA
Japonica Intermediate  241 52.30% 47.30% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430559445 G -> A LOC_Os04g51580.1 upstream_gene_variant ; 846.0bp to feature; MODIFIER silent_mutation Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0430559445 G -> A LOC_Os04g51590.1 upstream_gene_variant ; 4519.0bp to feature; MODIFIER silent_mutation Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0430559445 G -> A LOC_Os04g51580.2 upstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0430559445 G -> A LOC_Os04g51580-LOC_Os04g51590 intergenic_region ; MODIFIER silent_mutation Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430559445 7.77E-10 NA mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 9.20E-09 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 3.44E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 1.46E-07 1.72E-13 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 3.74E-09 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 4.70E-09 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 4.44E-28 2.07E-54 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 1.47E-10 3.64E-15 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 5.98E-07 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 1.46E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 8.12E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 9.79E-16 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 4.69E-09 6.88E-14 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 1.14E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 6.45E-07 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 1.07E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 1.45E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 8.79E-08 9.43E-29 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 9.11E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 NA 5.26E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 3.98E-07 1.77E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 1.79E-58 1.89E-69 mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 1.13E-25 2.97E-34 mr1745_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430559445 4.10E-08 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251