\
| Variant ID: vg0430559445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30559445 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCACATAAATTGTTTTTCTAGTGACAATTAATTCTTTTAAACTGGAGGAAGTGTGTAAATCTATTATATTATTAAAGGAATAGAAAAAGGAGCCTCCAC[G/A]
TTCGCTCTCATGGTCTAGAAATTCTCATATTAATTGGAGAAAAAGAAAAGGCAGAGTCCATATAGAAATATAATTTAGAAATAGTTGAGAAAGAAAATAG
CTATTTTCTTTCTCAACTATTTCTAAATTATATTTCTATATGGACTCTGCCTTTTCTTTTTCTCCAATTAATATGAGAATTTCTAGACCATGAGAGCGAA[C/T]
GTGGAGGCTCCTTTTTCTATTCCTTTAATAATATAATAGATTTACACACTTCCTCCAGTTTAAAAGAATTAATTGTCACTAGAAAAACAATTTATGTGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 12.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 79.30% | 20.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 22.70% | 76.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 52.30% | 47.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430559445 | G -> A | LOC_Os04g51580.1 | upstream_gene_variant ; 846.0bp to feature; MODIFIER | silent_mutation | Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0430559445 | G -> A | LOC_Os04g51590.1 | upstream_gene_variant ; 4519.0bp to feature; MODIFIER | silent_mutation | Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0430559445 | G -> A | LOC_Os04g51580.2 | upstream_gene_variant ; 2481.0bp to feature; MODIFIER | silent_mutation | Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| vg0430559445 | G -> A | LOC_Os04g51580-LOC_Os04g51590 | intergenic_region ; MODIFIER | silent_mutation | Average:31.923; most accessible tissue: Minghui63 flag leaf, score: 52.88 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430559445 | 7.77E-10 | NA | mr1064 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 9.20E-09 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 3.44E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 1.46E-07 | 1.72E-13 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 3.74E-09 | NA | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 4.70E-09 | mr1534 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 4.44E-28 | 2.07E-54 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 1.47E-10 | 3.64E-15 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 5.98E-07 | NA | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 1.46E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 8.12E-12 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 9.79E-16 | NA | mr1064_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 4.69E-09 | 6.88E-14 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 1.14E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 6.45E-07 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 1.07E-06 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 1.45E-09 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 8.79E-08 | 9.43E-29 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 9.11E-10 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | NA | 5.26E-06 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 3.98E-07 | 1.77E-13 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 1.79E-58 | 1.89E-69 | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 1.13E-25 | 2.97E-34 | mr1745_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430559445 | 4.10E-08 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |