\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430558693:

Variant ID: vg0430558693 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30558693
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTTTTTCCCCTTGAGAAAGCCAGGTTGATCATTAGTACTATATCGGCTGGTTTTATATTTTTTATTTTTGAATAAAAAAATGTAAGTTGATTTATA[A/T]
AAGTTCACTGAATTTTTAGTACTAGTAGTGGTGTAGTGGTGGGGCCCACGCCTGCAGGTAGTACTGCAGGTCGCGGCCGCCGGTACGGCCGTACGTACCC

Reverse complement sequence

GGGTACGTACGGCCGTACCGGCGGCCGCGACCTGCAGTACTACCTGCAGGCGTGGGCCCCACCACTACACCACTACTAGTACTAAAAATTCAGTGAACTT[T/A]
TATAAATCAACTTACATTTTTTTATTCAAAAATAAAAAATATAAAACCAGCCGATATAGTACTAATGATCAACCTGGCTTTCTCAAGGGGAAAAAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.30% 0.44% 0.00% NA
All Indica  2759 99.00% 0.80% 0.22% 0.00% NA
All Japonica  1512 88.50% 10.60% 0.93% 0.00% NA
Aus  269 22.30% 77.30% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 1.70% 0.76% 0.00% NA
Temperate Japonica  767 99.20% 0.10% 0.65% 0.00% NA
Tropical Japonica  504 72.00% 27.60% 0.40% 0.00% NA
Japonica Intermediate  241 88.80% 8.30% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430558693 A -> T LOC_Os04g51580.1 upstream_gene_variant ; 94.0bp to feature; MODIFIER silent_mutation Average:97.31; most accessible tissue: Callus, score: 99.398 N N N N
vg0430558693 A -> T LOC_Os04g51580.2 upstream_gene_variant ; 1729.0bp to feature; MODIFIER silent_mutation Average:97.31; most accessible tissue: Callus, score: 99.398 N N N N
vg0430558693 A -> T LOC_Os04g51580-LOC_Os04g51590 intergenic_region ; MODIFIER silent_mutation Average:97.31; most accessible tissue: Callus, score: 99.398 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430558693 A T 0.01 -0.01 -0.07 -0.02 -0.04 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430558693 NA 1.79E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 5.41E-06 3.61E-07 mr1050 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 9.87E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 7.11E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 3.49E-07 1.61E-13 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 3.00E-14 2.95E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 3.63E-06 7.76E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 4.91E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 4.43E-06 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 3.12E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 5.78E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 1.77E-08 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 1.15E-23 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 2.12E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 2.38E-06 NA mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 9.57E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 6.15E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 5.21E-21 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 2.13E-08 2.18E-08 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 1.58E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 NA 5.78E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430558693 3.37E-08 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251