\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430554222:

Variant ID: vg0430554222 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 30554222
Reference Allele: CAlternative Allele: T,CAT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTCATATTATAAGGCTTTTTAGCATTACCGACATTCATATAAATGTTAATATAAATGTTGATGAACTTAAACACATATATATGTCTAGATTCATTAA[C/T,CAT]
ATATATATCAATGCTAGAAATCTATTATATAATTAAAGGAATAGAAAAAGAAGCCTTCACGTTCGCTCTCATGGCTTAGAAATTCTCACATTAATCAGAG

Reverse complement sequence

CTCTGATTAATGTGAGAATTTCTAAGCCATGAGAGCGAACGTGAAGGCTTCTTTTTCTATTCCTTTAATTATATAATAGATTTCTAGCATTGATATATAT[G/A,ATG]
TTAATGAATCTAGACATATATATGTGTTTAAGTTCATCAACATTTATATTAACATTTATATGAATGTCGGTAATGCTAAAAAGCCTTATAATATGAAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 4.60% 3.49% 4.02% CAT: 0.04%
All Indica  2759 98.00% 0.60% 0.80% 0.65% NA
All Japonica  1512 79.90% 6.70% 5.82% 7.41% CAT: 0.13%
Aus  269 22.70% 36.80% 19.33% 21.19% NA
Indica I  595 99.00% 0.20% 0.67% 0.17% NA
Indica II  465 99.10% 0.20% 0.22% 0.43% NA
Indica III  913 99.00% 0.20% 0.22% 0.55% NA
Indica Intermediate  786 95.30% 1.50% 1.91% 1.27% NA
Temperate Japonica  767 95.40% 1.60% 2.48% 0.52% NA
Tropical Japonica  504 69.20% 11.50% 7.14% 11.71% CAT: 0.40%
Japonica Intermediate  241 52.70% 13.30% 13.69% 20.33% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 1.10% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430554222 C -> DEL N N silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0430554222 C -> CAT LOC_Os04g51570.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0430554222 C -> CAT LOC_Os04g51580.1 intron_variant ; MODIFIER silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0430554222 C -> CAT LOC_Os04g51580.2 intron_variant ; MODIFIER silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0430554222 C -> T LOC_Os04g51570.1 downstream_gene_variant ; 2086.0bp to feature; MODIFIER silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0430554222 C -> T LOC_Os04g51580.1 intron_variant ; MODIFIER silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N
vg0430554222 C -> T LOC_Os04g51580.2 intron_variant ; MODIFIER silent_mutation Average:58.872; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430554222 5.16E-10 NA mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 6.33E-09 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 2.33E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 1.04E-08 3.41E-14 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 4.97E-10 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 1.12E-09 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 1.90E-23 7.90E-51 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 8.69E-08 3.08E-13 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 7.65E-07 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 2.26E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 5.43E-13 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 3.69E-13 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 3.96E-07 4.11E-12 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 1.42E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 1.48E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 6.47E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 2.10E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 1.23E-10 3.74E-31 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 2.64E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 8.79E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 3.82E-08 5.39E-14 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 3.34E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 9.58E-40 3.15E-60 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 3.42E-14 3.84E-25 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 NA 5.26E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430554222 9.80E-08 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251