\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430549128:

Variant ID: vg0430549128 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30549128
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTCTTCTCTCAACCAAAGCTCACCATCGAGATGGCGTTAATTAGTTATTATTACTTCGTATTAGTACTACTAATTGTCTAGAGGCCACATGATTTGAC[T/C]
AATCACCACTGTTTTTGGTGCCTAGCACGGGTGACCTATCTGCCCAACGACTTGTAATTGGTCGTTTATTTCCACGGGCCCGTGACGGAGTGCGAACGAT

Reverse complement sequence

ATCGTTCGCACTCCGTCACGGGCCCGTGGAAATAAACGACCAATTACAAGTCGTTGGGCAGATAGGTCACCCGTGCTAGGCACCAAAAACAGTGGTGATT[A/G]
GTCAAATCATGTGGCCTCTAGACAATTAGTAGTACTAATACGAAGTAATAATAACTAATTAACGCCATCTCGATGGTGAGCTTTGGTTGAGAGAAGACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.20% 0.02% 0.00% NA
All Indica  2759 97.80% 2.10% 0.04% 0.00% NA
All Japonica  1512 80.00% 20.00% 0.00% 0.00% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 69.40% 30.60% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430549128 T -> C LOC_Os04g51570.1 upstream_gene_variant ; 1833.0bp to feature; MODIFIER silent_mutation Average:93.557; most accessible tissue: Minghui63 root, score: 98.596 N N N N
vg0430549128 T -> C LOC_Os04g51560.1 downstream_gene_variant ; 2551.0bp to feature; MODIFIER silent_mutation Average:93.557; most accessible tissue: Minghui63 root, score: 98.596 N N N N
vg0430549128 T -> C LOC_Os04g51580.1 downstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:93.557; most accessible tissue: Minghui63 root, score: 98.596 N N N N
vg0430549128 T -> C LOC_Os04g51580.2 downstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:93.557; most accessible tissue: Minghui63 root, score: 98.596 N N N N
vg0430549128 T -> C LOC_Os04g51560-LOC_Os04g51570 intergenic_region ; MODIFIER silent_mutation Average:93.557; most accessible tissue: Minghui63 root, score: 98.596 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430549128 T C -0.02 0.04 0.03 0.01 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430549128 1.42E-08 NA mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 6.33E-09 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 1.89E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 1.70E-08 7.39E-14 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 1.13E-08 NA mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 1.12E-09 mr1534 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 3.05E-21 8.91E-47 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 8.69E-08 3.08E-13 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 2.90E-07 NA mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 2.26E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 7.66E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 1.92E-11 NA mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 3.96E-07 4.11E-12 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 7.84E-06 mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 1.49E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 1.33E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 1.08E-08 1.40E-27 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 2.70E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 4.43E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 4.30E-08 1.03E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 3.34E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 1.98E-37 1.23E-56 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 3.42E-14 3.84E-25 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 NA 5.26E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430549128 7.70E-08 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251