\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430485059:

Variant ID: vg0430485059 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30485059
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTATTAGCCAGCTCTAAACATATTTTAATGAGATAAACGATGAGAGAGAAGAGCAGCGGGCTACAGATCTGTAGCCAGCTGCAGCACAGACTCCAAGA[T/C]
ACACTGTGTGTATGACATGTGGGACCATATATTAATAGTATAGCAAGCAACTATTATATGAATTGACTATTTGATTAGCTATAGATGAATTGGAGCTAGT

Reverse complement sequence

ACTAGCTCCAATTCATCTATAGCTAATCAAATAGTCAATTCATATAATAGTTGCTTGCTATACTATTAATATATGGTCCCACATGTCATACACACAGTGT[A/G]
TCTTGGAGTCTGTGCTGCAGCTGGCTACAGATCTGTAGCCCGCTGCTCTTCTCTCTCATCGTTTATCTCATTAAAATATGTTTAGAGCTGGCTAATAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 14.90% 0.02% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 58.90% 41.10% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 38.90% 61.00% 0.13% 0.00% NA
Tropical Japonica  504 84.70% 15.30% 0.00% 0.00% NA
Japonica Intermediate  241 68.50% 31.50% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430485059 T -> C LOC_Os04g51460.1 upstream_gene_variant ; 1567.0bp to feature; MODIFIER silent_mutation Average:95.678; most accessible tissue: Minghui63 flower, score: 97.811 N N N N
vg0430485059 T -> C LOC_Os04g51470.1 upstream_gene_variant ; 2060.0bp to feature; MODIFIER silent_mutation Average:95.678; most accessible tissue: Minghui63 flower, score: 97.811 N N N N
vg0430485059 T -> C LOC_Os04g51460-LOC_Os04g51470 intergenic_region ; MODIFIER silent_mutation Average:95.678; most accessible tissue: Minghui63 flower, score: 97.811 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430485059 T C -0.01 -0.02 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430485059 NA 5.39E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430485059 NA 5.67E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430485059 NA 2.10E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430485059 NA 1.89E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430485059 8.82E-06 NA mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430485059 NA 4.97E-08 mr1155_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430485059 NA 2.94E-08 mr1241_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251