\
| Variant ID: vg0430365122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30365122 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATGGTTGGGATGAAGCCTGGTATATATCTGACCGGGGCTAACGTGCCATCTCTAAGAGGCAACACGCTAGCTCCGGTTAGAGACGAGTGCCTAGAGGCT[C/T]
TCGTCTTGACGGGATGGGGCGAGGTGTGCGTCAGACCGCCAATCGCCACCTAACCCGTGATCTGACCGGTCTGTGACCGGTCACAGACCGGATAAAGGAA
TTCCTTTATCCGGTCTGTGACCGGTCACAGACCGGTCAGATCACGGGTTAGGTGGCGATTGGCGGTCTGACGCACACCTCGCCCCATCCCGTCAAGACGA[G/A]
AGCCTCTAGGCACTCGTCTCTAACCGGAGCTAGCGTGTTGCCTCTTAGAGATGGCACGTTAGCCCCGGTCAGATATATACCAGGCTTCATCCCAACCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 0.40% | 5.61% | 8.72% | NA |
| All Indica | 2759 | 85.70% | 0.60% | 5.33% | 8.34% | NA |
| All Japonica | 1512 | 86.40% | 0.00% | 1.92% | 11.71% | NA |
| Aus | 269 | 66.90% | 1.10% | 31.23% | 0.74% | NA |
| Indica I | 595 | 89.20% | 0.20% | 5.04% | 5.55% | NA |
| Indica II | 465 | 83.90% | 0.40% | 5.59% | 10.11% | NA |
| Indica III | 913 | 86.40% | 0.90% | 2.85% | 9.86% | NA |
| Indica Intermediate | 786 | 83.30% | 0.80% | 8.27% | 7.63% | NA |
| Temperate Japonica | 767 | 95.30% | 0.00% | 0.78% | 3.91% | NA |
| Tropical Japonica | 504 | 82.70% | 0.00% | 2.58% | 14.68% | NA |
| Japonica Intermediate | 241 | 65.60% | 0.00% | 4.15% | 30.29% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430365122 | C -> DEL | N | N | silent_mutation | Average:15.228; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| vg0430365122 | C -> T | LOC_Os04g51240.1 | upstream_gene_variant ; 1464.0bp to feature; MODIFIER | silent_mutation | Average:15.228; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| vg0430365122 | C -> T | LOC_Os04g51250.1 | downstream_gene_variant ; 807.0bp to feature; MODIFIER | silent_mutation | Average:15.228; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| vg0430365122 | C -> T | LOC_Os04g51240-LOC_Os04g51250 | intergenic_region ; MODIFIER | silent_mutation | Average:15.228; most accessible tissue: Zhenshan97 flag leaf, score: 36.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430365122 | 2.03E-06 | 2.03E-06 | mr1300 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430365122 | 3.50E-06 | 4.75E-06 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430365122 | NA | 4.40E-06 | mr1574 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |