\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430364199:

Variant ID: vg0430364199 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30364199
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AGAATGTACGTGCATGCTTTTATATCAGTAAGTACATGCGCGTTTGCATAAGCATATGCATCGGGAACTTAATCTATATACACAAGTCTTCCCGTGTACA[T/C]
ACCGTACATACCAACTTAAAAACATATCATAAAATATTCTATACAGAATTGTACAGGTACTTTTAGTAGTATTATATCTATGAGCAAAGTTTCATTTTCA

Reverse complement sequence

TGAAAATGAAACTTTGCTCATAGATATAATACTACTAAAAGTACCTGTACAATTCTGTATAGAATATTTTATGATATGTTTTTAAGTTGGTATGTACGGT[A/G]
TGTACACGGGAAGACTTGTGTATATAGATTAAGTTCCCGATGCATATGCTTATGCAAACGCGCATGTACTTACTGATATAAAAGCATGCACGTACATTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.80% 0.04% 0.00% NA
All Indica  2759 98.00% 2.00% 0.04% 0.00% NA
All Japonica  1512 9.70% 90.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.50% 0.13% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 16.10% 83.90% 0.00% 0.00% NA
Japonica Intermediate  241 15.40% 84.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430364199 T -> C LOC_Os04g51240.1 upstream_gene_variant ; 541.0bp to feature; MODIFIER silent_mutation Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0430364199 T -> C LOC_Os04g51250.1 downstream_gene_variant ; 1730.0bp to feature; MODIFIER silent_mutation Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0430364199 T -> C LOC_Os04g51240-LOC_Os04g51250 intergenic_region ; MODIFIER silent_mutation Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430364199 NA 3.14E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 8.62E-09 NA mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 1.99E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 4.22E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 6.66E-105 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 2.94E-99 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 6.98E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 2.64E-07 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 2.09E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 2.69E-65 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 2.32E-59 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 4.67E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 1.54E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 2.75E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 3.82E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 1.59E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 8.45E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 1.47E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 1.80E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430364199 NA 2.76E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251