\
| Variant ID: vg0430364199 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30364199 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 105. )
AGAATGTACGTGCATGCTTTTATATCAGTAAGTACATGCGCGTTTGCATAAGCATATGCATCGGGAACTTAATCTATATACACAAGTCTTCCCGTGTACA[T/C]
ACCGTACATACCAACTTAAAAACATATCATAAAATATTCTATACAGAATTGTACAGGTACTTTTAGTAGTATTATATCTATGAGCAAAGTTTCATTTTCA
TGAAAATGAAACTTTGCTCATAGATATAATACTACTAAAAGTACCTGTACAATTCTGTATAGAATATTTTATGATATGTTTTTAAGTTGGTATGTACGGT[A/G]
TGTACACGGGAAGACTTGTGTATATAGATTAAGTTCCCGATGCATATGCTTATGCAAACGCGCATGTACTTACTGATATAAAAGCATGCACGTACATTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 16.10% | 83.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.40% | 84.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430364199 | T -> C | LOC_Os04g51240.1 | upstream_gene_variant ; 541.0bp to feature; MODIFIER | silent_mutation | Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0430364199 | T -> C | LOC_Os04g51250.1 | downstream_gene_variant ; 1730.0bp to feature; MODIFIER | silent_mutation | Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0430364199 | T -> C | LOC_Os04g51240-LOC_Os04g51250 | intergenic_region ; MODIFIER | silent_mutation | Average:66.81; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430364199 | NA | 3.14E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | 8.62E-09 | NA | mr1301 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 1.99E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 4.22E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 6.66E-105 | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 2.94E-99 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 6.98E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | 2.64E-07 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 2.09E-11 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 2.69E-65 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 2.32E-59 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 4.67E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 1.54E-27 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 2.75E-29 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 3.82E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 1.59E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 8.45E-33 | mr1780_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 1.47E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 1.80E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430364199 | NA | 2.76E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |