\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430357265:

Variant ID: vg0430357265 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30357265
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGTATGAGAGCTCAGAAAACACACGCTGAGCCCCCTACCTGGCGCGCCAGATGACGGAGCTCGTGGCTCCTCACCGGGAGACCGCGCAGGCCCCCC[T/C]
TTTGCCAGTTCGGCCGGGGGCTTAGGGTGAGATCTCAAGCTCTCTCTGTGTGTGGAAAGATCACGTGCCCAGAAGAAACGCGAGACACGGACGATGTATA

Reverse complement sequence

TATACATCGTCCGTGTCTCGCGTTTCTTCTGGGCACGTGATCTTTCCACACACAGAGAGAGCTTGAGATCTCACCCTAAGCCCCCGGCCGAACTGGCAAA[A/G]
GGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCACGAGCTCCGTCATCTGGCGCGCCAGGTAGGGGGCTCAGCGTGTGTTTTCTGAGCTCTCATACTCTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 0.30% 13.80% 52.77% NA
All Indica  2759 6.80% 0.50% 16.46% 76.26% NA
All Japonica  1512 82.70% 0.10% 5.16% 12.04% NA
Aus  269 9.30% 0.00% 33.46% 57.25% NA
Indica I  595 2.40% 0.30% 9.75% 87.56% NA
Indica II  465 8.80% 0.90% 9.46% 80.86% NA
Indica III  913 8.30% 0.20% 24.10% 67.36% NA
Indica Intermediate  786 7.30% 0.60% 16.79% 75.32% NA
Temperate Japonica  767 93.90% 0.00% 0.65% 5.48% NA
Tropical Japonica  504 74.00% 0.20% 9.72% 16.07% NA
Japonica Intermediate  241 65.60% 0.00% 9.96% 24.48% NA
VI/Aromatic  96 67.70% 0.00% 15.62% 16.67% NA
Intermediate  90 41.10% 0.00% 16.67% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430357265 T -> C LOC_Os04g51230.1 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0430357265 T -> C LOC_Os04g51240.1 downstream_gene_variant ; 4613.0bp to feature; MODIFIER silent_mutation Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0430357265 T -> C LOC_Os04g51230-LOC_Os04g51240 intergenic_region ; MODIFIER silent_mutation Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 N N N N
vg0430357265 T -> DEL N N silent_mutation Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430357265 NA 1.10E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 1.44E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 1.83E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 9.44E-14 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 7.08E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 4.76E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 1.57E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 4.15E-06 NA mr1414 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 9.43E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 1.45E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 5.17E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265 NA 3.19E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251