\
| Variant ID: vg0430357265 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30357265 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAAGAGTATGAGAGCTCAGAAAACACACGCTGAGCCCCCTACCTGGCGCGCCAGATGACGGAGCTCGTGGCTCCTCACCGGGAGACCGCGCAGGCCCCCC[T/C]
TTTGCCAGTTCGGCCGGGGGCTTAGGGTGAGATCTCAAGCTCTCTCTGTGTGTGGAAAGATCACGTGCCCAGAAGAAACGCGAGACACGGACGATGTATA
TATACATCGTCCGTGTCTCGCGTTTCTTCTGGGCACGTGATCTTTCCACACACAGAGAGAGCTTGAGATCTCACCCTAAGCCCCCGGCCGAACTGGCAAA[A/G]
GGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCACGAGCTCCGTCATCTGGCGCGCCAGGTAGGGGGCTCAGCGTGTGTTTTCTGAGCTCTCATACTCTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.10% | 0.30% | 13.80% | 52.77% | NA |
| All Indica | 2759 | 6.80% | 0.50% | 16.46% | 76.26% | NA |
| All Japonica | 1512 | 82.70% | 0.10% | 5.16% | 12.04% | NA |
| Aus | 269 | 9.30% | 0.00% | 33.46% | 57.25% | NA |
| Indica I | 595 | 2.40% | 0.30% | 9.75% | 87.56% | NA |
| Indica II | 465 | 8.80% | 0.90% | 9.46% | 80.86% | NA |
| Indica III | 913 | 8.30% | 0.20% | 24.10% | 67.36% | NA |
| Indica Intermediate | 786 | 7.30% | 0.60% | 16.79% | 75.32% | NA |
| Temperate Japonica | 767 | 93.90% | 0.00% | 0.65% | 5.48% | NA |
| Tropical Japonica | 504 | 74.00% | 0.20% | 9.72% | 16.07% | NA |
| Japonica Intermediate | 241 | 65.60% | 0.00% | 9.96% | 24.48% | NA |
| VI/Aromatic | 96 | 67.70% | 0.00% | 15.62% | 16.67% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 16.67% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430357265 | T -> C | LOC_Os04g51230.1 | upstream_gene_variant ; 132.0bp to feature; MODIFIER | silent_mutation | Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0430357265 | T -> C | LOC_Os04g51240.1 | downstream_gene_variant ; 4613.0bp to feature; MODIFIER | silent_mutation | Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0430357265 | T -> C | LOC_Os04g51230-LOC_Os04g51240 | intergenic_region ; MODIFIER | silent_mutation | Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0430357265 | T -> DEL | N | N | silent_mutation | Average:8.458; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430357265 | NA | 1.10E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 1.44E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 1.83E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 9.44E-14 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 7.08E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 4.76E-08 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 1.57E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | 4.15E-06 | NA | mr1414 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 9.43E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 1.45E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 5.17E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430357265 | NA | 3.19E-06 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |