Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430357265:

Variant ID: vg0430357265 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30357265
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGAGTATGAGAGCTCAGAAAACACACGCTGAGCCCCCTACCTGGCGCGCCAGATGACGGAGCTCGTGGCTCCTCACCGGGAGACCGCGCAGGCCCCCC[T/C]
TTTGCCAGTTCGGCCGGGGGCTTAGGGTGAGATCTCAAGCTCTCTCTGTGTGTGGAAAGATCACGTGCCCAGAAGAAACGCGAGACACGGACGATGTATA

Reverse complement sequence

TATACATCGTCCGTGTCTCGCGTTTCTTCTGGGCACGTGATCTTTCCACACACAGAGAGAGCTTGAGATCTCACCCTAAGCCCCCGGCCGAACTGGCAAA[A/G]
GGGGGGCCTGCGCGGTCTCCCGGTGAGGAGCCACGAGCTCCGTCATCTGGCGCGCCAGGTAGGGGGCTCAGCGTGTGTTTTCTGAGCTCTCATACTCTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.10%	0.30%	13.80%	52.77%	NA
All Indica	2759	6.80%	0.50%	16.46%	76.26%	NA
All Japonica	1512	82.70%	0.10%	5.16%	12.04%	NA
Aus	269	9.30%	0.00%	33.46%	57.25%	NA
Indica I	595	2.40%	0.30%	9.75%	87.56%	NA
Indica II	465	8.80%	0.90%	9.46%	80.86%	NA
Indica III	913	8.30%	0.20%	24.10%	67.36%	NA
Indica Intermediate	786	7.30%	0.60%	16.79%	75.32%	NA
Temperate Japonica	767	93.90%	0.00%	0.65%	5.48%	NA
Tropical Japonica	504	74.00%	0.20%	9.72%	16.07%	NA
Japonica Intermediate	241	65.60%	0.00%	9.96%	24.48%	NA
VI/Aromatic	96	67.70%	0.00%	15.62%	16.67%	NA
Intermediate	90	41.10%	0.00%	16.67%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430357265	T -> C	LOC_Os04g51230.1	upstream_gene_variant ; 132.0bp to feature; MODIFIER	silent_mutation	Average:8.458; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0430357265	T -> C	LOC_Os04g51240.1	downstream_gene_variant ; 4613.0bp to feature; MODIFIER	silent_mutation	Average:8.458; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0430357265	T -> C	LOC_Os04g51230-LOC_Os04g51240	intergenic_region ; MODIFIER	silent_mutation	Average:8.458; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0430357265	T -> DEL	N	N	silent_mutation	Average:8.458; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430357265	NA	1.10E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	1.44E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	1.83E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	9.44E-14	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	7.08E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	4.76E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	1.57E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	4.15E-06	NA	mr1414	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	9.43E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	1.45E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	5.17E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430357265	NA	3.19E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251