\
| Variant ID: vg0430327954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30327954 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )
GTGCCCTAAACAATTCGATAGAAGACTTCTATTTTGGAGAACATTAACCTTTTCATTTCATTAAGAAATGGGAGAGTTTCTCAGGGAAAAAAAAGTGAAT[C/T]
AGCAAAAAAAAAAAGAGGGTGCGTTCTATACTACGCATTTCCAGTTTGTACACCTCCTTATTTTTCACGCACATGTTTCTCAAAATGCTAAATGTATGTT
AACATACATTTAGCATTTTGAGAAACATGTGCGTGAAAAATAAGGAGGTGTACAAACTGGAAATGCGTAGTATAGAACGCACCCTCTTTTTTTTTTTGCT[G/A]
ATTCACTTTTTTTTCCCTGAGAAACTCTCCCATTTCTTAATGAAATGAAAAGGTTAATGTTCTCCAAAATAGAAGTCTTCTATCGAATTGTTTAGGGCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 12.60% | 5.84% | 2.31% | NA |
| All Indica | 2759 | 72.20% | 21.20% | 5.00% | 1.59% | NA |
| All Japonica | 1512 | 88.10% | 0.10% | 7.74% | 4.10% | NA |
| Aus | 269 | 94.10% | 0.70% | 5.20% | 0.00% | NA |
| Indica I | 595 | 46.60% | 48.90% | 3.70% | 0.84% | NA |
| Indica II | 465 | 81.10% | 7.10% | 8.60% | 3.23% | NA |
| Indica III | 913 | 78.60% | 16.40% | 3.94% | 0.99% | NA |
| Indica Intermediate | 786 | 78.90% | 14.10% | 5.09% | 1.91% | NA |
| Temperate Japonica | 767 | 78.10% | 0.00% | 13.95% | 7.95% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 8.90% | 7.78% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430327954 | C -> DEL | N | N | silent_mutation | Average:36.074; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| vg0430327954 | C -> T | LOC_Os04g51190-LOC_Os04g51200 | intergenic_region ; MODIFIER | silent_mutation | Average:36.074; most accessible tissue: Minghui63 panicle, score: 86.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430327954 | NA | 2.43E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430327954 | NA | 1.82E-07 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430327954 | NA | 6.69E-07 | mr1406 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430327954 | NA | 5.80E-08 | mr1406 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430327954 | NA | 4.52E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |