\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430327954:

Variant ID: vg0430327954 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30327954
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCCCTAAACAATTCGATAGAAGACTTCTATTTTGGAGAACATTAACCTTTTCATTTCATTAAGAAATGGGAGAGTTTCTCAGGGAAAAAAAAGTGAAT[C/T]
AGCAAAAAAAAAAAGAGGGTGCGTTCTATACTACGCATTTCCAGTTTGTACACCTCCTTATTTTTCACGCACATGTTTCTCAAAATGCTAAATGTATGTT

Reverse complement sequence

AACATACATTTAGCATTTTGAGAAACATGTGCGTGAAAAATAAGGAGGTGTACAAACTGGAAATGCGTAGTATAGAACGCACCCTCTTTTTTTTTTTGCT[G/A]
ATTCACTTTTTTTTCCCTGAGAAACTCTCCCATTTCTTAATGAAATGAAAAGGTTAATGTTCTCCAAAATAGAAGTCTTCTATCGAATTGTTTAGGGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 12.60% 5.84% 2.31% NA
All Indica  2759 72.20% 21.20% 5.00% 1.59% NA
All Japonica  1512 88.10% 0.10% 7.74% 4.10% NA
Aus  269 94.10% 0.70% 5.20% 0.00% NA
Indica I  595 46.60% 48.90% 3.70% 0.84% NA
Indica II  465 81.10% 7.10% 8.60% 3.23% NA
Indica III  913 78.60% 16.40% 3.94% 0.99% NA
Indica Intermediate  786 78.90% 14.10% 5.09% 1.91% NA
Temperate Japonica  767 78.10% 0.00% 13.95% 7.95% NA
Tropical Japonica  504 99.20% 0.20% 0.40% 0.20% NA
Japonica Intermediate  241 96.70% 0.00% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 8.90% 7.78% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430327954 C -> DEL N N silent_mutation Average:36.074; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N
vg0430327954 C -> T LOC_Os04g51190-LOC_Os04g51200 intergenic_region ; MODIFIER silent_mutation Average:36.074; most accessible tissue: Minghui63 panicle, score: 86.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430327954 NA 2.43E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430327954 NA 1.82E-07 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430327954 NA 6.69E-07 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430327954 NA 5.80E-08 mr1406 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430327954 NA 4.52E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251