\
| Variant ID: vg0430293825 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30293825 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )
ATAACTCGTACGACAGGTAACGCTACTCCAATCAGCGGGAGAGGGCAAAGCCACGCTACACTTTCAACAAATCCCTAAAGGAAGCAATGCCTGCTAACGA[C/T]
CACAACCGATCCTCCGAAAGGATGGATTATTTTTCTTCTATAAAGAAAGCCCATTCTGAAAATAGTACGTGTAGTAAGCGTTGTTTTCCTAAGAAAAAAT
ATTTTTTCTTAGGAAAACAACGCTTACTACACGTACTATTTTCAGAATGGGCTTTCTTTATAGAAGAAAAATAATCCATCCTTTCGGAGGATCGGTTGTG[G/A]
TCGTTAGCAGGCATTGCTTCCTTTAGGGATTTGTTGAAAGTGTAGCGTGGCTTTGCCCTCTCCCGCTGATTGGAGTAGCGTTACCTGTCGTACGAGTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 12.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.80% | 30.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.50% | 57.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430293825 | C -> T | LOC_Os04g51150.1 | upstream_gene_variant ; 3961.0bp to feature; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Callus, score: 89.258 | N | N | N | N |
| vg0430293825 | C -> T | LOC_Os04g51160.1 | upstream_gene_variant ; 785.0bp to feature; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Callus, score: 89.258 | N | N | N | N |
| vg0430293825 | C -> T | LOC_Os04g51166.1 | downstream_gene_variant ; 959.0bp to feature; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Callus, score: 89.258 | N | N | N | N |
| vg0430293825 | C -> T | LOC_Os04g51172.1 | downstream_gene_variant ; 4039.0bp to feature; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Callus, score: 89.258 | N | N | N | N |
| vg0430293825 | C -> T | LOC_Os04g51160-LOC_Os04g51166 | intergenic_region ; MODIFIER | silent_mutation | Average:60.458; most accessible tissue: Callus, score: 89.258 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430293825 | NA | 1.88E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430293825 | NA | 3.24E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430293825 | NA | 3.55E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430293825 | 2.11E-08 | NA | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430293825 | NA | 9.40E-10 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |