\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430293825:

Variant ID: vg0430293825 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30293825
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACTCGTACGACAGGTAACGCTACTCCAATCAGCGGGAGAGGGCAAAGCCACGCTACACTTTCAACAAATCCCTAAAGGAAGCAATGCCTGCTAACGA[C/T]
CACAACCGATCCTCCGAAAGGATGGATTATTTTTCTTCTATAAAGAAAGCCCATTCTGAAAATAGTACGTGTAGTAAGCGTTGTTTTCCTAAGAAAAAAT

Reverse complement sequence

ATTTTTTCTTAGGAAAACAACGCTTACTACACGTACTATTTTCAGAATGGGCTTTCTTTATAGAAGAAAAATAATCCATCCTTTCGGAGGATCGGTTGTG[G/A]
TCGTTAGCAGGCATTGCTTCCTTTAGGGATTTGTTGAAAGTGTAGCGTGGCTTTGCCCTCTCCCGCTGATTGGAGTAGCGTTACCTGTCGTACGAGTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 12.70% 0.02% 0.00% NA
All Indica  2759 95.40% 4.60% 0.00% 0.00% NA
All Japonica  1512 69.80% 30.20% 0.00% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 89.00% 11.00% 0.00% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 94.00% 6.00% 0.00% 0.00% NA
Tropical Japonica  504 42.50% 57.50% 0.00% 0.00% NA
Japonica Intermediate  241 49.80% 50.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430293825 C -> T LOC_Os04g51150.1 upstream_gene_variant ; 3961.0bp to feature; MODIFIER silent_mutation Average:60.458; most accessible tissue: Callus, score: 89.258 N N N N
vg0430293825 C -> T LOC_Os04g51160.1 upstream_gene_variant ; 785.0bp to feature; MODIFIER silent_mutation Average:60.458; most accessible tissue: Callus, score: 89.258 N N N N
vg0430293825 C -> T LOC_Os04g51166.1 downstream_gene_variant ; 959.0bp to feature; MODIFIER silent_mutation Average:60.458; most accessible tissue: Callus, score: 89.258 N N N N
vg0430293825 C -> T LOC_Os04g51172.1 downstream_gene_variant ; 4039.0bp to feature; MODIFIER silent_mutation Average:60.458; most accessible tissue: Callus, score: 89.258 N N N N
vg0430293825 C -> T LOC_Os04g51160-LOC_Os04g51166 intergenic_region ; MODIFIER silent_mutation Average:60.458; most accessible tissue: Callus, score: 89.258 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430293825 NA 1.88E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430293825 NA 3.24E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430293825 NA 3.55E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430293825 2.11E-08 NA mr1745_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430293825 NA 9.40E-10 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251