Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0430202848:

Variant ID: vg0430202848 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30202848
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCTAGTCCATTTTGTGAGAGAGCTCCACCCAGCTTTACTCCCAGTTTTGGTGGAGCTGAAACTGTTTGGCTGAGTTCCAGCTTCAGAAGGGGTGGAG[C/A]
TGGAGCTGGAGTTGTGCCAAACAGGCCTAAATGGCCAGATTACCCCCGGGTTTTGAACCACCCATCCGCCGCGCGCACGACGGGCACGACCCAGACACGC

Reverse complement sequence

GCGTGTCTGGGTCGTGCCCGTCGTGCGCGCGGCGGATGGGTGGTTCAAAACCCGGGGGTAATCTGGCCATTTAGGCCTGTTTGGCACAACTCCAGCTCCA[G/T]
CTCCACCCCTTCTGAAGCTGGAACTCAGCCAAACAGTTTCAGCTCCACCAAAACTGGGAGTAAAGCTGGGTGGAGCTCTCTCACAAAATGGACTAGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	35.80%	2.18%	3.22%	NA
All Indica	2759	32.80%	58.10%	3.70%	5.36%	NA
All Japonica	1512	97.40%	2.60%	0.07%	0.00%	NA
Aus	269	86.60%	12.30%	0.00%	1.12%	NA
Indica I	595	52.80%	38.30%	6.89%	2.02%	NA
Indica II	465	17.20%	72.50%	4.30%	6.02%	NA
Indica III	913	29.10%	63.00%	0.55%	7.34%	NA
Indica Intermediate	786	31.30%	58.90%	4.58%	5.22%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	93.30%	6.50%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430202848	C -> DEL	N	N	silent_mutation	Average:92.183; most accessible tissue: Zhenshan97 young leaf, score: 98.676	N	N	N	N
vg0430202848	C -> A	LOC_Os04g51009.1	upstream_gene_variant ; 2144.0bp to feature; MODIFIER	silent_mutation	Average:92.183; most accessible tissue: Zhenshan97 young leaf, score: 98.676	N	N	N	N
vg0430202848	C -> A	LOC_Os04g51020.1	upstream_gene_variant ; 2481.0bp to feature; MODIFIER	silent_mutation	Average:92.183; most accessible tissue: Zhenshan97 young leaf, score: 98.676	N	N	N	N
vg0430202848	C -> A	LOC_Os04g51009.2	upstream_gene_variant ; 2227.0bp to feature; MODIFIER	silent_mutation	Average:92.183; most accessible tissue: Zhenshan97 young leaf, score: 98.676	N	N	N	N
vg0430202848	C -> A	LOC_Os04g51009-LOC_Os04g51020	intergenic_region ; MODIFIER	silent_mutation	Average:92.183; most accessible tissue: Zhenshan97 young leaf, score: 98.676	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0430202848	C	A	-0.05	-0.07	-0.04	-0.04	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430202848	NA	1.40E-13	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	1.90E-14	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	3.03E-13	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	8.05E-09	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	1.70E-08	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	5.98E-09	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	9.81E-07	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	3.57E-06	mr1099_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	1.57E-13	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	8.28E-12	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202848	NA	6.31E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251