\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430202038:

Variant ID: vg0430202038 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 30202038
Reference Allele: TAlternative Allele: C,TTTTTGA
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GACCTCATAATAAAAATATTAATAAATAGGTCCTTGACGTAAGTGTCACTGGAATAGGAAACCTATTTGTAATTTGTAATAAAAATATTAACATTTTAGT[T/C,TTTTTGA]
ATTTTTTTTACAAATTGCTCCACAGCACCATTGCCATTGGAGTCAACCCCTTCACATAGCAGCTTAGCTTTCGCGAGGAGCGAGGGGGTAACACTAATAT

Reverse complement sequence

ATATTAGTGTTACCCCCTCGCTCCTCGCGAAAGCTAAGCTGCTATGTGAAGGGGTTGACTCCAATGGCAATGGTGCTGTGGAGCAATTTGTAAAAAAAAT[A/G,TCAAAAA]
ACTAAAATGTTAATATTTTTATTACAAATTACAAATAGGTTTCCTATTCCAGTGACACTTACGTCAAGGACCTATTTATTAATATTTTTATTATGAGGTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.50% 41.10% 1.21% 13.16% TTTTTGA: 0.04%
All Indica  2759 10.50% 67.00% 1.85% 20.66% NA
All Japonica  1512 97.30% 2.60% 0.07% 0.07% NA
Aus  269 69.10% 13.40% 1.12% 15.61% TTTTTGA: 0.74%
Indica I  595 4.50% 46.70% 2.52% 46.22% NA
Indica II  465 9.50% 82.60% 0.65% 7.31% NA
Indica III  913 10.40% 70.50% 2.63% 16.43% NA
Indica Intermediate  786 15.80% 69.00% 1.15% 14.12% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 93.10% 6.50% 0.20% 0.20% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 64.40% 23.30% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430202038 T -> C LOC_Os04g51009.1 upstream_gene_variant ; 1334.0bp to feature; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> C LOC_Os04g51020.1 upstream_gene_variant ; 3291.0bp to feature; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> C LOC_Os04g51009.2 upstream_gene_variant ; 1417.0bp to feature; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> C LOC_Os04g51009-LOC_Os04g51020 intergenic_region ; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> DEL N N silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> TTTTTGA LOC_Os04g51009.1 upstream_gene_variant ; 1335.0bp to feature; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> TTTTTGA LOC_Os04g51020.1 upstream_gene_variant ; 3290.0bp to feature; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> TTTTTGA LOC_Os04g51009.2 upstream_gene_variant ; 1418.0bp to feature; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N
vg0430202038 T -> TTTTTGA LOC_Os04g51009-LOC_Os04g51020 intergenic_region ; MODIFIER silent_mutation Average:77.41; most accessible tissue: Callus, score: 92.926 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430202038 T C 0.03 0.02 0.0 -0.01 0.02 0.01
vg0430202038 T TTTTT* -0.08 -0.61 -0.23 -0.13 -0.35 -0.45

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430202038 NA 1.14E-13 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 9.63E-15 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 6.68E-14 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 8.01E-10 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 4.13E-06 3.12E-09 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 4.58E-10 mr1347 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 4.66E-07 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 2.21E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 4.83E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 4.10E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 7.06E-13 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 1.04E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 1.04E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430202038 NA 2.54E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251