Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430128516:

Variant ID: vg0430128516 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30128516
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTATATTTAATAATGAATCAAATGATAAAAAAAGAATTAATAATTACTTACTTTTTTTAATAAGACAAACGGTCAAACATGTTTTAAAAAATCAACGG[A/C,T]
GTCAAATATTTTGGGACGGAGGGAGTATTATTTATACTTATTATCACTATATATTATACTAAACTCTCACATCAACGCGCGAGGTTTCACCTAGTTAAGT

Reverse complement sequence

ACTTAACTAGGTGAAACCTCGCGCGTTGATGTGAGAGTTTAGTATAATATATAGTGATAATAAGTATAAATAATACTCCCTCCGTCCCAAAATATTTGAC[T/G,A]
CCGTTGATTTTTTAAAACATGTTTGACCGTTTGTCTTATTAAAAAAAGTAAGTAATTATTAATTCTTTTTTTATCATTTGATTCATTATTAAATATACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	24.40%	0.30%	0.00%	T: 0.02%
All Indica	2759	88.80%	11.10%	0.11%	0.00%	T: 0.04%
All Japonica	1512	55.30%	44.10%	0.60%	0.00%	NA
Aus	269	41.60%	58.00%	0.37%	0.00%	NA
Indica I	595	98.30%	1.50%	0.17%	0.00%	NA
Indica II	465	87.70%	12.30%	0.00%	0.00%	NA
Indica III	913	84.20%	15.60%	0.11%	0.00%	T: 0.11%
Indica Intermediate	786	87.50%	12.30%	0.13%	0.00%	NA
Temperate Japonica	767	40.20%	58.70%	1.17%	0.00%	NA
Tropical Japonica	504	70.40%	29.60%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	28.20%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430128516	A -> C	LOC_Os04g50920.1	upstream_gene_variant ; 3975.0bp to feature; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 46.737	N	N	N	N
vg0430128516	A -> C	LOC_Os04g50910-LOC_Os04g50920	intergenic_region ; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 46.737	N	N	N	N
vg0430128516	A -> T	LOC_Os04g50920.1	upstream_gene_variant ; 3975.0bp to feature; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 46.737	N	N	N	N
vg0430128516	A -> T	LOC_Os04g50910-LOC_Os04g50920	intergenic_region ; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 46.737	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430128516	NA	2.22E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	7.86E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	1.02E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	1.61E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	6.14E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	4.27E-08	mr1241_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	7.22E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	5.88E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	2.04E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516	NA	3.48E-06	mr1896_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251