\
| Variant ID: vg0430128516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30128516 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 89. )
TAGTATATTTAATAATGAATCAAATGATAAAAAAAGAATTAATAATTACTTACTTTTTTTAATAAGACAAACGGTCAAACATGTTTTAAAAAATCAACGG[A/C,T]
GTCAAATATTTTGGGACGGAGGGAGTATTATTTATACTTATTATCACTATATATTATACTAAACTCTCACATCAACGCGCGAGGTTTCACCTAGTTAAGT
ACTTAACTAGGTGAAACCTCGCGCGTTGATGTGAGAGTTTAGTATAATATATAGTGATAATAAGTATAAATAATACTCCCTCCGTCCCAAAATATTTGAC[T/G,A]
CCGTTGATTTTTTAAAACATGTTTGACCGTTTGTCTTATTAAAAAAAGTAAGTAATTATTAATTCTTTTTTTATCATTTGATTCATTATTAAATATACTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.20% | 24.40% | 0.30% | 0.00% | T: 0.02% |
| All Indica | 2759 | 88.80% | 11.10% | 0.11% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 55.30% | 44.10% | 0.60% | 0.00% | NA |
| Aus | 269 | 41.60% | 58.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.20% | 15.60% | 0.11% | 0.00% | T: 0.11% |
| Indica Intermediate | 786 | 87.50% | 12.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 40.20% | 58.70% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430128516 | A -> C | LOC_Os04g50920.1 | upstream_gene_variant ; 3975.0bp to feature; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 46.737 | N | N | N | N |
| vg0430128516 | A -> C | LOC_Os04g50910-LOC_Os04g50920 | intergenic_region ; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 46.737 | N | N | N | N |
| vg0430128516 | A -> T | LOC_Os04g50920.1 | upstream_gene_variant ; 3975.0bp to feature; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 46.737 | N | N | N | N |
| vg0430128516 | A -> T | LOC_Os04g50910-LOC_Os04g50920 | intergenic_region ; MODIFIER | silent_mutation | Average:26.871; most accessible tissue: Callus, score: 46.737 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430128516 | NA | 2.22E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 7.86E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 1.02E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 1.61E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 6.14E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 4.27E-08 | mr1241_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 7.22E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 5.88E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 2.04E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430128516 | NA | 3.48E-06 | mr1896_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |