\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430128516:

Variant ID: vg0430128516 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30128516
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.31, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTATATTTAATAATGAATCAAATGATAAAAAAAGAATTAATAATTACTTACTTTTTTTAATAAGACAAACGGTCAAACATGTTTTAAAAAATCAACGG[A/C,T]
GTCAAATATTTTGGGACGGAGGGAGTATTATTTATACTTATTATCACTATATATTATACTAAACTCTCACATCAACGCGCGAGGTTTCACCTAGTTAAGT

Reverse complement sequence

ACTTAACTAGGTGAAACCTCGCGCGTTGATGTGAGAGTTTAGTATAATATATAGTGATAATAAGTATAAATAATACTCCCTCCGTCCCAAAATATTTGAC[T/G,A]
CCGTTGATTTTTTAAAACATGTTTGACCGTTTGTCTTATTAAAAAAAGTAAGTAATTATTAATTCTTTTTTTATCATTTGATTCATTATTAAATATACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.40% 0.30% 0.00% T: 0.02%
All Indica  2759 88.80% 11.10% 0.11% 0.00% T: 0.04%
All Japonica  1512 55.30% 44.10% 0.60% 0.00% NA
Aus  269 41.60% 58.00% 0.37% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 87.70% 12.30% 0.00% 0.00% NA
Indica III  913 84.20% 15.60% 0.11% 0.00% T: 0.11%
Indica Intermediate  786 87.50% 12.30% 0.13% 0.00% NA
Temperate Japonica  767 40.20% 58.70% 1.17% 0.00% NA
Tropical Japonica  504 70.40% 29.60% 0.00% 0.00% NA
Japonica Intermediate  241 71.80% 28.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430128516 A -> C LOC_Os04g50920.1 upstream_gene_variant ; 3975.0bp to feature; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 46.737 N N N N
vg0430128516 A -> C LOC_Os04g50910-LOC_Os04g50920 intergenic_region ; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 46.737 N N N N
vg0430128516 A -> T LOC_Os04g50920.1 upstream_gene_variant ; 3975.0bp to feature; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 46.737 N N N N
vg0430128516 A -> T LOC_Os04g50910-LOC_Os04g50920 intergenic_region ; MODIFIER silent_mutation Average:26.871; most accessible tissue: Callus, score: 46.737 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430128516 NA 2.22E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 7.86E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 1.02E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 1.61E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 6.14E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 4.27E-08 mr1241_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 7.22E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 5.88E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 2.04E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430128516 NA 3.48E-06 mr1896_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251