\
| Variant ID: vg0430105040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30105040 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAGCAAACTAAAATACGAGAATTAAAATAAGTAATATTGAAAGAATAGTCCATCTAAAACCCAACATTATATTAAATAAATTTTCAAATAAAATAAAAT[G/A]
AATTCTAAAATTGGATTTTCAATACAAATTCCAAAGACCCCACGAAGTTAACCCCTCACTTCCCCTTTTATACTGAGTTCGGTTATTCACTTTCCCAACT
AGTTGGGAAAGTGAATAACCGAACTCAGTATAAAAGGGGAAGTGAGGGGTTAACTTCGTGGGGTCTTTGGAATTTGTATTGAAAATCCAATTTTAGAATT[C/T]
ATTTTATTTTATTTGAAAATTTATTTAATATAATGTTGGGTTTTAGATGGACTATTCTTTCAATATTACTTATTTTAATTCTCGTATTTTAGTTTGCTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.30% | 0.40% | 1.27% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 95.20% | 1.10% | 3.64% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 91.30% | 2.10% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430105040 | G -> A | LOC_Os04g50880.1 | downstream_gene_variant ; 2168.0bp to feature; MODIFIER | silent_mutation | Average:39.859; most accessible tissue: Callus, score: 79.217 | N | N | N | N |
| vg0430105040 | G -> A | LOC_Os04g50890.1 | downstream_gene_variant ; 4931.0bp to feature; MODIFIER | silent_mutation | Average:39.859; most accessible tissue: Callus, score: 79.217 | N | N | N | N |
| vg0430105040 | G -> A | LOC_Os04g50870-LOC_Os04g50880 | intergenic_region ; MODIFIER | silent_mutation | Average:39.859; most accessible tissue: Callus, score: 79.217 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430105040 | 7.88E-06 | 7.88E-06 | mr1200 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430105040 | NA | 4.87E-06 | mr1441 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430105040 | 7.91E-07 | 7.91E-07 | mr1855 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |