\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430060754:

Variant ID: vg0430060754 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30060754
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCTCTCATCCGATTCCTGCGTTTTTCCTGCGGTCCAATCAAACGGTCATTCCTGTGTTTTCCAATCCTCTGTTTTGCACCTGTATTCCTGTCAGAAT[C/T]
ATGCGTTTTTCATATTCTTCCGTTTTTCTATTTCTACGATTCAAAGGGGCCCTTATATTTTAAAATGTAGGTAGCAGTAAATAATCCTCCTATATGAGTA

Reverse complement sequence

TACTCATATAGGAGGATTATTTACTGCTACCTACATTTTAAAATATAAGGGCCCCTTTGAATCGTAGAAATAGAAAAACGGAAGAATATGAAAAACGCAT[G/A]
ATTCTGACAGGAATACAGGTGCAAAACAGAGGATTGGAAAACACAGGAATGACCGTTTGATTGGACCGCAGGAAAAACGCAGGAATCGGATGAGAGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 20.60% 0.19% 0.00% NA
All Indica  2759 65.10% 34.60% 0.25% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 64.00% 35.50% 0.50% 0.00% NA
Indica II  465 30.30% 69.70% 0.00% 0.00% NA
Indica III  913 81.30% 18.70% 0.00% 0.00% NA
Indica Intermediate  786 67.80% 31.70% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430060754 C -> T LOC_Os04g50810.1 upstream_gene_variant ; 1193.0bp to feature; MODIFIER silent_mutation Average:44.065; most accessible tissue: Callus, score: 59.666 N N N N
vg0430060754 C -> T LOC_Os04g50820.1 upstream_gene_variant ; 1673.0bp to feature; MODIFIER silent_mutation Average:44.065; most accessible tissue: Callus, score: 59.666 N N N N
vg0430060754 C -> T LOC_Os04g50810-LOC_Os04g50820 intergenic_region ; MODIFIER silent_mutation Average:44.065; most accessible tissue: Callus, score: 59.666 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430060754 NA 6.19E-15 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 1.89E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 4.56E-06 1.66E-21 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 3.33E-11 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 3.02E-07 5.82E-18 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 3.05E-08 1.10E-14 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 1.66E-06 1.77E-09 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 2.70E-06 5.22E-10 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 4.89E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 7.98E-08 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 5.90E-18 mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 3.59E-09 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 1.78E-06 7.23E-20 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 9.03E-08 4.22E-17 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 1.01E-06 1.73E-13 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 9.18E-07 5.69E-14 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 3.94E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 2.39E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 2.85E-10 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430060754 NA 7.50E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251