\
| Variant ID: vg0430060754 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30060754 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )
ATCTCTCTCATCCGATTCCTGCGTTTTTCCTGCGGTCCAATCAAACGGTCATTCCTGTGTTTTCCAATCCTCTGTTTTGCACCTGTATTCCTGTCAGAAT[C/T]
ATGCGTTTTTCATATTCTTCCGTTTTTCTATTTCTACGATTCAAAGGGGCCCTTATATTTTAAAATGTAGGTAGCAGTAAATAATCCTCCTATATGAGTA
TACTCATATAGGAGGATTATTTACTGCTACCTACATTTTAAAATATAAGGGCCCCTTTGAATCGTAGAAATAGAAAAACGGAAGAATATGAAAAACGCAT[G/A]
ATTCTGACAGGAATACAGGTGCAAAACAGAGGATTGGAAAACACAGGAATGACCGTTTGATTGGACCGCAGGAAAAACGCAGGAATCGGATGAGAGAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 20.60% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 65.10% | 34.60% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 64.00% | 35.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 30.30% | 69.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 67.80% | 31.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430060754 | C -> T | LOC_Os04g50810.1 | upstream_gene_variant ; 1193.0bp to feature; MODIFIER | silent_mutation | Average:44.065; most accessible tissue: Callus, score: 59.666 | N | N | N | N |
| vg0430060754 | C -> T | LOC_Os04g50820.1 | upstream_gene_variant ; 1673.0bp to feature; MODIFIER | silent_mutation | Average:44.065; most accessible tissue: Callus, score: 59.666 | N | N | N | N |
| vg0430060754 | C -> T | LOC_Os04g50810-LOC_Os04g50820 | intergenic_region ; MODIFIER | silent_mutation | Average:44.065; most accessible tissue: Callus, score: 59.666 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430060754 | NA | 6.19E-15 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 1.89E-07 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 4.56E-06 | 1.66E-21 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 3.33E-11 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 3.02E-07 | 5.82E-18 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 3.05E-08 | 1.10E-14 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 1.66E-06 | 1.77E-09 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 2.70E-06 | 5.22E-10 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 4.89E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 7.98E-08 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 5.90E-18 | mr1138_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 3.59E-09 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 1.78E-06 | 7.23E-20 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 9.03E-08 | 4.22E-17 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 1.01E-06 | 1.73E-13 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | 9.18E-07 | 5.69E-14 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 3.94E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 2.39E-10 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 2.85E-10 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430060754 | NA | 7.50E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |