\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430038876:

Variant ID: vg0430038876 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30038876
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCTATAAAAGAGATACATAGGCAACCTACACATTAATGAGAATAGTTTCTTTCATCTGCCGTCACGGGCGAAGTCTACGTACTATTTATTTCCCCCT[T/C]
CTCCAAATTATTAATTCATGAATAATATACTAGAACTCCACCTAGTCATCGTACTCCTCAGAAATATTGAATGAAATGTGTTATTGAAATTGCCTTGATA

Reverse complement sequence

TATCAAGGCAATTTCAATAACACATTTCATTCAATATTTCTGAGGAGTACGATGACTAGGTGGAGTTCTAGTATATTATTCATGAATTAATAATTTGGAG[A/G]
AGGGGGAAATAAATAGTACGTAGACTTCGCCCGTGACGGCAGATGAAAGAAACTATTCTCATTAATGTGTAGGTTGCCTATGTATCTCTTTTATAGATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 22.80% 0.21% 0.06% NA
All Indica  2759 63.70% 36.00% 0.29% 0.07% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 75.50% 24.20% 0.00% 0.37% NA
Indica I  595 63.70% 36.30% 0.00% 0.00% NA
Indica II  465 29.90% 69.50% 0.65% 0.00% NA
Indica III  913 79.60% 20.40% 0.00% 0.00% NA
Indica Intermediate  786 65.10% 34.00% 0.64% 0.25% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430038876 T -> C LOC_Os04g50770-LOC_Os04g50780 intergenic_region ; MODIFIER silent_mutation Average:49.332; most accessible tissue: Zhenshan97 root, score: 82.361 N N N N
vg0430038876 T -> DEL N N silent_mutation Average:49.332; most accessible tissue: Zhenshan97 root, score: 82.361 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430038876 NA 5.64E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 2.66E-07 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 8.51E-16 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 9.08E-09 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 2.94E-07 3.87E-17 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 1.57E-09 8.20E-16 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 2.17E-07 3.69E-10 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 1.06E-07 1.81E-11 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 1.96E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 5.20E-07 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 2.09E-17 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 4.85E-10 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 6.50E-15 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 2.87E-07 5.07E-16 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 3.05E-10 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 2.05E-06 3.57E-13 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 1.81E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 4.38E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 9.22E-11 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430038876 NA 1.50E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251