\
| Variant ID: vg0430038876 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 30038876 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 250. )
ATATCTATAAAAGAGATACATAGGCAACCTACACATTAATGAGAATAGTTTCTTTCATCTGCCGTCACGGGCGAAGTCTACGTACTATTTATTTCCCCCT[T/C]
CTCCAAATTATTAATTCATGAATAATATACTAGAACTCCACCTAGTCATCGTACTCCTCAGAAATATTGAATGAAATGTGTTATTGAAATTGCCTTGATA
TATCAAGGCAATTTCAATAACACATTTCATTCAATATTTCTGAGGAGTACGATGACTAGGTGGAGTTCTAGTATATTATTCATGAATTAATAATTTGGAG[A/G]
AGGGGGAAATAAATAGTACGTAGACTTCGCCCGTGACGGCAGATGAAAGAAACTATTCTCATTAATGTGTAGGTTGCCTATGTATCTCTTTTATAGATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 22.80% | 0.21% | 0.06% | NA |
| All Indica | 2759 | 63.70% | 36.00% | 0.29% | 0.07% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.50% | 24.20% | 0.00% | 0.37% | NA |
| Indica I | 595 | 63.70% | 36.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 29.90% | 69.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 65.10% | 34.00% | 0.64% | 0.25% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0430038876 | T -> C | LOC_Os04g50770-LOC_Os04g50780 | intergenic_region ; MODIFIER | silent_mutation | Average:49.332; most accessible tissue: Zhenshan97 root, score: 82.361 | N | N | N | N |
| vg0430038876 | T -> DEL | N | N | silent_mutation | Average:49.332; most accessible tissue: Zhenshan97 root, score: 82.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0430038876 | NA | 5.64E-12 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 2.66E-07 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 8.51E-16 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 9.08E-09 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | 2.94E-07 | 3.87E-17 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | 1.57E-09 | 8.20E-16 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | 2.17E-07 | 3.69E-10 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | 1.06E-07 | 1.81E-11 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 1.96E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 5.20E-07 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 2.09E-17 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 4.85E-10 | mr1138_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 6.50E-15 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | 2.87E-07 | 5.07E-16 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 3.05E-10 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | 2.05E-06 | 3.57E-13 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 1.81E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 4.38E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 9.22E-11 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0430038876 | NA | 1.50E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |