Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430035048:

Variant ID: vg0430035048 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30035048
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCTTTTTTTTTTCTCTTGCACTAAAATCTGAATGGATGATAGGTGTATTACAACTTGTCGACGTTTGATGTCGCGATTCTGGTATTTGCATAGTATGG[A/G]
GATCGTCGGTACTAGGATATACGCGAGACAGAGGCAAAAGAGATGGGGGCGAGGATTTTTATACAGGTTCGGGCCCCTGAATTGTCAGGTAATAACCCTA

Reverse complement sequence

TAGGGTTATTACCTGACAATTCAGGGGCCCGAACCTGTATAAAAATCCTCGCCCCCATCTCTTTTGCCTCTGTCTCGCGTATATCCTAGTACCGACGATC[T/C]
CCATACTATGCAAATACCAGAATCGCGACATCAAACGTCGACAAGTTGTAATACACCTATCATCCATTCAGATTTTAGTGCAAGAGAAAAAAAAAAGGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.90%	0.19%	0.00%	NA
All Indica	2759	54.30%	45.50%	0.22%	0.00%	NA
All Japonica	1512	52.50%	47.40%	0.07%	0.00%	NA
Aus	269	11.90%	88.10%	0.00%	0.00%	NA
Indica I	595	75.50%	24.50%	0.00%	0.00%	NA
Indica II	465	22.60%	77.40%	0.00%	0.00%	NA
Indica III	913	57.00%	43.00%	0.00%	0.00%	NA
Indica Intermediate	786	53.90%	45.30%	0.76%	0.00%	NA
Temperate Japonica	767	91.90%	8.10%	0.00%	0.00%	NA
Tropical Japonica	504	7.70%	92.10%	0.20%	0.00%	NA
Japonica Intermediate	241	20.70%	79.30%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	31.10%	66.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430035048	A -> G	LOC_Os04g50770.1	upstream_gene_variant ; 4363.0bp to feature; MODIFIER	silent_mutation	Average:41.016; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0430035048	A -> G	LOC_Os04g50770-LOC_Os04g50780	intergenic_region ; MODIFIER	silent_mutation	Average:41.016; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430035048	NA	2.21E-07	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	8.91E-08	1.36E-11	mr1174	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	8.41E-08	1.61E-16	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	8.07E-06	4.30E-09	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	3.67E-11	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.14E-06	mr1406	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.60E-06	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	3.70E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	3.40E-12	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.40E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	2.80E-06	6.65E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	2.62E-08	1.29E-19	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	1.80E-07	6.53E-14	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	1.14E-09	3.45E-22	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.94E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.06E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	8.64E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	5.63E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	3.58E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.25E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	4.34E-11	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	1.03E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	3.96E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	6.80E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430035048	NA	7.44E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251