\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430000535:

Variant ID: vg0430000535 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30000535
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTATATGGACTACTCTTTCAATATTGCTTATTTTTAATTCCGAATCTCAACTATTTTTAGATTGTATTTCTATTTGAACTCTTTTTTTCTTTTTCTC[C/T]
GATTAATGTGGGAATTTCTAACCCCCACAGCGAACGTGGTGACTTCTTTCAAGCCTGTTTTAATAATATAATAGATAGATAGATAGATAGATAAGCGTTA

Reverse complement sequence

TAACGCTTATCTATCTATCTATCTATCTATTATATTATTAAAACAGGCTTGAAAGAAGTCACCACGTTCGCTGTGGGGGTTAGAAATTCCCACATTAATC[G/A]
GAGAAAAAGAAAAAAAGAGTTCAAATAGAAATACAATCTAAAAATAGTTGAGATTCGGAATTAAAAATAAGCAATATTGAAAGAGTAGTCCATATAGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.30% 0.17% 0.00% NA
All Indica  2759 68.90% 30.90% 0.22% 0.00% NA
All Japonica  1512 73.40% 26.50% 0.13% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 81.00% 19.00% 0.00% 0.00% NA
Indica II  465 28.40% 70.80% 0.86% 0.00% NA
Indica III  913 79.50% 20.50% 0.00% 0.00% NA
Indica Intermediate  786 71.40% 28.40% 0.25% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 28.40% 71.20% 0.40% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430000535 C -> T LOC_Os04g50680.1 upstream_gene_variant ; 3274.0bp to feature; MODIFIER silent_mutation Average:74.485; most accessible tissue: Minghui63 flower, score: 86.112 N N N N
vg0430000535 C -> T LOC_Os04g50690.1 upstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:74.485; most accessible tissue: Minghui63 flower, score: 86.112 N N N N
vg0430000535 C -> T LOC_Os04g50700.1 upstream_gene_variant ; 947.0bp to feature; MODIFIER silent_mutation Average:74.485; most accessible tissue: Minghui63 flower, score: 86.112 N N N N
vg0430000535 C -> T LOC_Os04g50710.1 upstream_gene_variant ; 3772.0bp to feature; MODIFIER silent_mutation Average:74.485; most accessible tissue: Minghui63 flower, score: 86.112 N N N N
vg0430000535 C -> T LOC_Os04g50690-LOC_Os04g50700 intergenic_region ; MODIFIER silent_mutation Average:74.485; most accessible tissue: Minghui63 flower, score: 86.112 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430000535 C T 0.05 0.04 0.03 0.0 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430000535 NA 1.87E-15 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 9.79E-07 1.07E-12 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 4.40E-11 1.84E-22 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 4.98E-13 1.68E-22 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 7.90E-08 8.85E-13 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 5.71E-06 1.89E-11 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 1.97E-06 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 1.93E-07 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 1.14E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 2.13E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 7.04E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 3.39E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 3.24E-12 3.63E-29 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 1.89E-13 3.32E-27 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 6.87E-14 4.27E-32 mr1347_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 1.50E-13 2.07E-27 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 1.49E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 1.19E-07 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 6.19E-06 4.23E-09 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000535 NA 4.67E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251