Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430000326:

Variant ID: vg0430000326 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 30000326
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTATATTTTCTAATTTCAGAATTTTTTTTATTTTTATTCTGAATTTTAATTAATCTATGTATGGACTTTTTTTTTCAATATTCCTTATTTTTTAATTC[C/T]
GAATTTCAATTATTTTTAAATTGTATTCCTACTTGGACTTTTCTTTTTTTTTCTAATTTTGGATTTTATTTTATTTTTATTCTAAATTTTGATTAATCTT

Reverse complement sequence

AAGATTAATCAAAATTTAGAATAAAAATAAAATAAAATCCAAAATTAGAAAAAAAAAGAAAAGTCCAAGTAGGAATACAATTTAAAAATAATTGAAATTC[G/A]
GAATTAAAAAATAAGGAATATTGAAAAAAAAAGTCCATACATAGATTAATTAAAATTCAGAATAAAAATAAAAAAAATTCTGAAATTAGAAAATATAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	21.20%	0.38%	0.00%	NA
All Indica	2759	69.90%	29.60%	0.47%	0.00%	NA
All Japonica	1512	99.60%	0.30%	0.13%	0.00%	NA
Aus	269	42.00%	58.00%	0.00%	0.00%	NA
Indica I	595	81.00%	18.80%	0.17%	0.00%	NA
Indica II	465	34.40%	64.70%	0.86%	0.00%	NA
Indica III	913	79.60%	20.00%	0.33%	0.00%	NA
Indica Intermediate	786	71.20%	28.10%	0.64%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	5.20%	1.04%	0.00%	NA
Intermediate	90	75.60%	22.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430000326	C -> T	LOC_Os04g50680.1	upstream_gene_variant ; 3065.0bp to feature; MODIFIER	silent_mutation	Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0430000326	C -> T	LOC_Os04g50690.1	upstream_gene_variant ; 1567.0bp to feature; MODIFIER	silent_mutation	Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0430000326	C -> T	LOC_Os04g50700.1	upstream_gene_variant ; 1156.0bp to feature; MODIFIER	silent_mutation	Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0430000326	C -> T	LOC_Os04g50710.1	upstream_gene_variant ; 3981.0bp to feature; MODIFIER	silent_mutation	Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0430000326	C -> T	LOC_Os04g50690-LOC_Os04g50700	intergenic_region ; MODIFIER	silent_mutation	Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430000326	NA	2.64E-08	mr1138	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	3.42E-08	6.66E-16	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	6.99E-11	4.06E-20	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	7.79E-17	1.51E-28	mr1174	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	5.42E-07	1.20E-09	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	1.07E-09	4.09E-16	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	NA	5.71E-10	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	2.75E-07	8.97E-10	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	NA	1.48E-08	mr1138_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	5.19E-09	9.96E-16	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	9.04E-16	5.38E-30	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	2.90E-09	4.27E-11	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	7.32E-14	1.44E-26	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	NA	2.55E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	NA	1.56E-12	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	1.36E-06	2.67E-09	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	NA	8.19E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326	NA	4.69E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251