\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430000326:

Variant ID: vg0430000326 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30000326
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTATATTTTCTAATTTCAGAATTTTTTTTATTTTTATTCTGAATTTTAATTAATCTATGTATGGACTTTTTTTTTCAATATTCCTTATTTTTTAATTC[C/T]
GAATTTCAATTATTTTTAAATTGTATTCCTACTTGGACTTTTCTTTTTTTTTCTAATTTTGGATTTTATTTTATTTTTATTCTAAATTTTGATTAATCTT

Reverse complement sequence

AAGATTAATCAAAATTTAGAATAAAAATAAAATAAAATCCAAAATTAGAAAAAAAAAGAAAAGTCCAAGTAGGAATACAATTTAAAAATAATTGAAATTC[G/A]
GAATTAAAAAATAAGGAATATTGAAAAAAAAAGTCCATACATAGATTAATTAAAATTCAGAATAAAAATAAAAAAAATTCTGAAATTAGAAAATATAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.20% 0.38% 0.00% NA
All Indica  2759 69.90% 29.60% 0.47% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 42.00% 58.00% 0.00% 0.00% NA
Indica I  595 81.00% 18.80% 0.17% 0.00% NA
Indica II  465 34.40% 64.70% 0.86% 0.00% NA
Indica III  913 79.60% 20.00% 0.33% 0.00% NA
Indica Intermediate  786 71.20% 28.10% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430000326 C -> T LOC_Os04g50680.1 upstream_gene_variant ; 3065.0bp to feature; MODIFIER silent_mutation Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0430000326 C -> T LOC_Os04g50690.1 upstream_gene_variant ; 1567.0bp to feature; MODIFIER silent_mutation Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0430000326 C -> T LOC_Os04g50700.1 upstream_gene_variant ; 1156.0bp to feature; MODIFIER silent_mutation Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0430000326 C -> T LOC_Os04g50710.1 upstream_gene_variant ; 3981.0bp to feature; MODIFIER silent_mutation Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0430000326 C -> T LOC_Os04g50690-LOC_Os04g50700 intergenic_region ; MODIFIER silent_mutation Average:35.773; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430000326 NA 2.64E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 3.42E-08 6.66E-16 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 6.99E-11 4.06E-20 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 7.79E-17 1.51E-28 mr1174 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 5.42E-07 1.20E-09 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 1.07E-09 4.09E-16 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 NA 5.71E-10 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 2.75E-07 8.97E-10 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 NA 1.48E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 5.19E-09 9.96E-16 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 9.04E-16 5.38E-30 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 2.90E-09 4.27E-11 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 7.32E-14 1.44E-26 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 NA 2.55E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 NA 1.56E-12 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 1.36E-06 2.67E-09 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 NA 8.19E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430000326 NA 4.69E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251