Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429963778:

Variant ID: vg0429963778 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 29963778
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATTAGTATGTACTTCATCTTTCCTAAAATATAATGGATTTTAGATGGATAGATACATTTTAGTACTATAAATGTAGACATACAACTTGTTCAGATTC[G/A]
TATTAATATGATGCATCCCATCCATTCAAAATCTATTATATTTTAGGATGAAAGAAGTACAGTATATCACTTCATAAACATGCAGGTTCTACAACTAGTT

Reverse complement sequence

AACTAGTTGTAGAACCTGCATGTTTATGAAGTGATATACTGTACTTCTTTCATCCTAAAATATAATAGATTTTGAATGGATGGGATGCATCATATTAATA[C/T]
GAATCTGAACAAGTTGTATGTCTACATTTATAGTACTAAAATGTATCTATCCATCTAAAATCCATTATATTTTAGGAAAGATGAAGTACATACTAATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.80%	8.10%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	77.20%	22.70%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	92.30%	7.60%	0.13%	0.00%	NA
Tropical Japonica	504	76.60%	23.40%	0.00%	0.00%	NA
Japonica Intermediate	241	30.30%	69.30%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0429963778	G -> A	LOC_Os04g50200.1	upstream_gene_variant ; 4140.0bp to feature; MODIFIER	silent_mutation	Average:51.738; most accessible tissue: Callus, score: 77.805	N	N	N	N
vg0429963778	G -> A	LOC_Os04g50204.1	upstream_gene_variant ; 1199.0bp to feature; MODIFIER	silent_mutation	Average:51.738; most accessible tissue: Callus, score: 77.805	N	N	N	N
vg0429963778	G -> A	LOC_Os04g50200-LOC_Os04g50204	intergenic_region ; MODIFIER	silent_mutation	Average:51.738; most accessible tissue: Callus, score: 77.805	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0429963778	1.51E-06	1.50E-06	mr1197_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251