\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429950282:

Variant ID: vg0429950282 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29950282
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTCCTGCAAGCCTGGAGCTGCGACGAGGGTTAGTAGAGCTGTATTCGGCAAGGCGAGCAATGCGATAGCGCTTCGCAAGAATCGGGCAGCTTTTGGC[C/G]
GGCGGCGTAGACGACAATCGGTCAAGAAGCGGCGGTGTAACAGCCTTGAAAAGGTTGCCCAACCTGTTTGAGTGCGGCGATGTGTGATCCGCTGTTGGCG

Reverse complement sequence

CGCCAACAGCGGATCACACATCGCCGCACTCAAACAGGTTGGGCAACCTTTTCAAGGCTGTTACACCGCCGCTTCTTGACCGATTGTCGTCTACGCCGCC[G/C]
GCCAAAAGCTGCCCGATTCTTGCGAAGCGCTATCGCATTGCTCGCCTTGCCGAATACAGCTCTACTAACCCTCGTCGCAGCTCCAGGCTTGCAGGAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 15.70% 0.02% 0.47% NA
All Indica  2759 72.90% 26.40% 0.04% 0.72% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.30% 18.30% 0.17% 0.17% NA
Indica II  465 34.20% 64.70% 0.00% 1.08% NA
Indica III  913 83.70% 15.90% 0.00% 0.44% NA
Indica Intermediate  786 76.70% 22.00% 0.00% 1.27% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429950282 C -> DEL LOC_Os04g50192.1 N frameshift_variant Average:67.109; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg0429950282 C -> G LOC_Os04g50192.1 synonymous_variant ; p.Pro124Pro; LOW synonymous_codon Average:67.109; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429950282 NA 3.59E-14 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 1.43E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 6.34E-09 1.15E-24 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 3.29E-08 4.32E-16 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 1.11E-13 4.28E-29 mr1174 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 2.53E-16 4.94E-28 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 5.13E-10 2.90E-15 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 6.81E-10 2.76E-16 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 9.82E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 7.31E-10 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 3.44E-07 1.36E-06 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 5.00E-07 1.44E-09 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 7.60E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 1.75E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 5.21E-12 2.16E-29 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 4.91E-15 3.81E-29 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 7.67E-14 1.99E-24 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 3.54E-14 1.09E-26 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 2.12E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 2.53E-12 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 3.44E-06 3.90E-07 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 1.55E-06 2.63E-09 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 1.32E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429950282 NA 4.60E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251