\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429947446:

Variant ID: vg0429947446 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29947446
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTTTGGAGGTTCGTGCATAAGCCAGTTGCGTGGCCAAAGCGACCAAGGAGATCGGTGAAGGCTTTCACATCTTCTTTGTTCGGGTTTATGAAGATAG[C/T]
TGCGTCATCAGCATACAAGGATGTGCGGAAACGTACCGCTTTTCCTCGTAATTTGCTTATCGCCCCAAGCTCAGTGGCCTTGTCTAGCAAACGTTGTAGG

Reverse complement sequence

CCTACAACGTTTGCTAGACAAGGCCACTGAGCTTGGGGCGATAAGCAAATTACGAGGAAAAGCGGTACGTTTCCGCACATCCTTGTATGCTGATGACGCA[G/A]
CTATCTTCATAAACCCGAACAAAGAAGATGTGAAAGCCTTCACCGATCTCCTTGGTCGCTTTGGCCACGCAACTGGCTTATGCACGAACCTCCAAAAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 15.70% 0.00% 0.49% NA
All Indica  2759 72.90% 26.30% 0.00% 0.76% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.50% 18.20% 0.00% 0.34% NA
Indica II  465 34.20% 64.50% 0.00% 1.29% NA
Indica III  913 83.70% 15.90% 0.00% 0.44% NA
Indica Intermediate  786 76.80% 22.00% 0.00% 1.15% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429947446 C -> DEL LOC_Os04g50192.1 N frameshift_variant Average:42.806; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0429947446 C -> T LOC_Os04g50192.1 missense_variant ; p.Ala926Thr; MODERATE nonsynonymous_codon ; A926T Average:42.806; most accessible tissue: Zhenshan97 panicle, score: 61.671 benign 1.282 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429947446 NA 2.22E-14 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 2.13E-08 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 6.85E-09 7.30E-24 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 1.10E-08 3.16E-16 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 1.13E-13 1.94E-29 mr1174 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 8.61E-16 1.48E-27 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 8.99E-11 2.64E-16 mr1347 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 5.62E-10 2.84E-16 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 1.43E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 7.92E-10 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 1.41E-07 4.91E-07 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 4.53E-07 1.21E-09 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 6.51E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 1.73E-08 mr1138_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 4.95E-14 1.40E-32 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 1.16E-15 1.25E-29 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 1.07E-14 1.84E-25 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 1.99E-14 7.09E-27 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 1.96E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 1.34E-12 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 6.15E-07 8.29E-08 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 9.12E-07 1.88E-09 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 1.45E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429947446 NA 8.46E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251