\
| Variant ID: vg0429945987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 29945987 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )
GAATAGAGAAGGAGAACTTTACAAAGCGAAAGGACAAAAAGAAAGGAGCTAGGACCTTTGGTCCGAGCTAACTAAAAGAAAGCCAGCTATTAAGACTTCT[C/T]
GCTCCTGCTAAGGCCCAAGTTTTGGCCTCTTCCTTGATCTTGGCTAAAAGAGAGATAGCTGAAAGCTCCTTCTGTTGGAAGGTTCTGCGATTCCTTTCGC
GCGAAAGGAATCGCAGAACCTTCCAACAGAAGGAGCTTTCAGCTATCTCTCTTTTAGCCAAGATCAAGGAAGAGGCCAAAACTTGGGCCTTAGCAGGAGC[G/A]
AGAAGTCTTAATAGCTGGCTTTCTTTTAGTTAGCTCGGACCAAAGGTCCTAGCTCCTTTCTTTTTGTCCTTTCGCTTTGTAAAGTTCTCCTTCTCTATTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 69.40% | 30.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.40% | 72.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429945987 | C -> T | LOC_Os04g50188.1 | synonymous_variant ; p.Ala101Ala; LOW | synonymous_codon | Average:50.544; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0429945987 | C -> T | LOC_Os04g50188.1 | synonymous_variant ; p.Ala101Ala; LOW | nonsynonymous_codon ; A101V | Average:50.544; most accessible tissue: Minghui63 panicle, score: 62.157 | unknown | unknown | TOLERATED | 0.20 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429945987 | 5.33E-07 | NA | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 2.04E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 3.24E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 2.34E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 1.57E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 1.08E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 1.47E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 7.69E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | 5.07E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | 4.39E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 1.07E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 4.13E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 1.05E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429945987 | NA | 6.24E-15 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |