\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429945960:

Variant ID: vg0429945960 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29945960
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAATCAACGAGCGCCAATTTCATTGAATAGAGAAGGAGAACTTTACAAAGCGAAAGGACAAAAAGAAAGGAGCTAGGACCTTTGGTCCGAGCTAACT[A/G]
AAAGAAAGCCAGCTATTAAGACTTCTCGCTCCTGCTAAGGCCCAAGTTTTGGCCTCTTCCTTGATCTTGGCTAAAAGAGAGATAGCTGAAAGCTCCTTCT

Reverse complement sequence

AGAAGGAGCTTTCAGCTATCTCTCTTTTAGCCAAGATCAAGGAAGAGGCCAAAACTTGGGCCTTAGCAGGAGCGAGAAGTCTTAATAGCTGGCTTTCTTT[T/C]
AGTTAGCTCGGACCAAAGGTCCTAGCTCCTTTCTTTTTGTCCTTTCGCTTTGTAAAGTTCTCCTTCTCTATTCAATGAAATTGGCGCTCGTTGATTTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 15.60% 0.36% 0.00% NA
All Indica  2759 73.30% 26.20% 0.54% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.50% 18.50% 0.00% 0.00% NA
Indica II  465 35.30% 63.40% 1.29% 0.00% NA
Indica III  913 83.80% 15.80% 0.44% 0.00% NA
Indica Intermediate  786 77.20% 22.10% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429945960 A -> G LOC_Os04g50188.1 synonymous_variant ; p.Phe110Phe; LOW synonymous_codon Average:50.943; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429945960 NA 4.40E-14 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 7.90E-09 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 5.10E-06 7.93E-20 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 4.78E-06 1.89E-12 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 2.62E-11 1.07E-25 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 5.08E-13 5.59E-24 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 7.34E-09 5.64E-14 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 1.12E-08 1.13E-14 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 1.08E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 7.73E-09 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 7.57E-08 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 1.80E-06 1.12E-15 mr1138_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 6.86E-06 1.93E-09 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 1.76E-07 2.34E-24 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 3.91E-09 1.92E-23 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 4.22E-08 2.20E-19 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 7.49E-07 3.39E-20 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 4.74E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 1.21E-11 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 2.93E-06 1.47E-12 mr1354_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 1.75E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 4.23E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429945960 NA 2.02E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251