Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0429938561:

Variant ID: vg0429938561 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 29938561
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CAGACCGGCGTGTGGCCGGTCTAACCGGCCCTCAACCGGCGGTCTGACCGGCAAACACACGGCGGTCAGGCCGGCCCACTCGGAGGAAACCGGTAGACTT[C/T,A]
CAAATTTTGGCAATCTTTACTATTTTAATCCTAGATGCCAAATTTGGATGTAAACAGGTACCACCGGTACTTGCCAAAACGTGCTAATGATCTACAGTGT

Reverse complement sequence

ACACTGTAGATCATTAGCACGTTTTGGCAAGTACCGGTGGTACCTGTTTACATCCAAATTTGGCATCTAGGATTAAAATAGTAAAGATTGCCAAAATTTG[G/A,T]
AAGTCTACCGGTTTCCTCCGAGTGGGCCGGCCTGACCGCCGTGTGTTTGCCGGTCAGACCGCCGGTTGAGGGCCGGTTAGACCGGCCACACGCCGGTCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 9.70% 0.04% 0.00% A: 0.04%
All Indica  2759 92.60% 7.20% 0.04% 0.00% A: 0.07%
All Japonica  1512 83.50% 16.40% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.20% 0.00% 0.00% A: 0.17%
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 84.70% 15.30% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 3.80% 0.13% 0.00% A: 0.13%
Temperate Japonica  767 92.60% 7.30% 0.13% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 35.30% 64.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0429938561 C -> A LOC_Os04g50172.1 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> A LOC_Os04g50176.1 upstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> A LOC_Os04g50180.1 downstream_gene_variant ; 2693.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> A LOC_Os04g50172-LOC_Os04g50176 intergenic_region ; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> T LOC_Os04g50172.1 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> T LOC_Os04g50176.1 upstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> T LOC_Os04g50180.1 downstream_gene_variant ; 2693.0bp to feature; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N
vg0429938561 C -> T LOC_Os04g50172-LOC_Os04g50176 intergenic_region ; MODIFIER silent_mutation Average:92.998; most accessible tissue: Zhenshan97 panicle, score: 98.362 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0429938561 C A -0.03 -0.01 0.01 -0.03 -0.04 -0.05
vg0429938561 C T -0.03 -0.02 0.0 -0.01 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0429938561 NA 6.61E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429938561 4.92E-13 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429938561 4.72E-06 1.65E-10 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429938561 NA 1.55E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429938561 NA 1.56E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0429938561 NA 1.60E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251