\
| Variant ID: vg0429937896 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 29937896 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 123. )
CGTTGATGTACTCATCCATAGCTTTGCGGTCCTCTCCTTCGAAATCCTCCAATGTGACCGGTATCACATTGGCTGGTTCCACCTCCGTCTTGGATGGCGG[C/T]
TTCGTCATGGCGAAGTCGAAGTTGAGTTGACGATGAACGGATCTCCTCCCCAGCGGAGTCGCCAAAAATCGTGTTGGCAACTTTTTTGACAAGTTGACAA
TTGTCAACTTGTCAAAAAAGTTGCCAACACGATTTTTGGCGACTCCGCTGGGGAGGAGATCCGTTCATCGTCAACTCAACTTCGACTTCGCCATGACGAA[G/A]
CCGCCATCCAAGACGGAGGTGGAACCAGCCAATGTGATACCGGTCACATTGGAGGATTTCGAAGGAGAGGACCGCAAAGCTATGGATGAGTACATCAACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.20% | 15.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 73.50% | 26.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 35.50% | 64.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.60% | 22.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0429937896 | C -> T | LOC_Os04g50172.1 | synonymous_variant ; p.Lys3Lys; LOW | synonymous_codon | Average:63.698; most accessible tissue: Zhenshan97 flower, score: 78.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0429937896 | NA | 1.04E-12 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 1.80E-07 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 2.15E-06 | 1.52E-20 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 2.76E-12 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 6.36E-12 | 6.11E-26 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 7.46E-14 | 4.08E-24 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 5.75E-09 | 3.96E-14 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 9.41E-09 | 9.04E-15 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 9.22E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 1.49E-08 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 1.85E-07 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 1.43E-16 | mr1138_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 5.87E-10 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 1.69E-08 | 3.95E-24 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 4.06E-10 | 3.05E-22 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 3.98E-09 | 9.20E-19 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | 2.18E-08 | 8.72E-19 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 8.70E-12 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 7.38E-13 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0429937896 | NA | 3.61E-06 | mr1406_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |